Euxoa mimallonis

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records340

Data sources6

Biological traits0

DNA specimens21

eDNA detections0

Sources6 archives

Databases and archives Euxoa mimallonis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF340 records

DNA & barcodingBOLD21 specimens

01Narrative

Euxoa mimallonis is a species of moth of the family Noctuidae first described by Smith in 1890. It is found in North America from Nova Scotia west to coastal British Columbia, south in the east to Michigan and Minnesota, in the west to central California and New Mexico. The wingspan is 38–42 mm. Adults are on wing from July to September. There is one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa mimallonis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

49Cmostly conserved

130Avariable

211Avariable

214Avariable

217Gvariable

268Tvariable

343Cvariable

415Avariable

592Avariable

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.77%

Haplotypes7

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa auripennissame genus2.7%Euxoa citricolorsame genus2.9%Euxoa chorissame genus3.2%Euxoa catenulasame genus3.2%Euxoa cinereopallidussame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor45

Museum / vouchered295

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 20≤1 km 5≤10 km 13>10 km 3

41 georeferenced · 4 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 5≤1 km 57≤10 km 59>10 km 6

127 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence295

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	94
East Lansing, US	47
New Haven, US	35
Denver, US	25
Royal Saskatchewan Museumlocation not on record	19
St. Paul, US	12
Vernal, US	10
San Diego, US	9
Oregon State Arthropod Collectionlocation not on record	9
Colorado State Universitylocation not on record	7
Helsinki, FI	3
Brussels, BE	3
WWUlocation not on record	3
RBINS-Scientific Heritagelocation not on record	2
Mississippi State, US	1
ASUlocation not on record	1

16 institutions · 280 of 295 vouchered records shown · 15 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)