Euxoa medialis

Smith · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records255

Data sources7

Biological traits0

DNA specimens14

eDNA detections15

Sources7 archives

Databases and archives Euxoa medialis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility255 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF255 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD14 specimens

01Narrative

Euxoa medialis, the median-banded dart, is a moth of the family Noctuidae. The species was first described by Smith in 1888. It is found in North America from southern Manitoba and central Wisconsin, west to southwest Alberta and California; north to southern Alberta and south to south-central Mexico. The wingspan is about 40 mm. Adults are on wing in September in Alberta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa medialis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

10Cmostly conserved

91Cmostly conserved

172Tmostly conserved

181Amostly conserved

217Gmostly conserved

328Gvariable

337Amostly conserved

343Tmostly conserved

346Tvariable

349Cmostly conserved

367Cmostly conserved

385Cmostly conserved

415Amostly conserved

421Amostly conserved

433Gmostly conserved

451Cmostly conserved

532Cmostly conserved

542Tmostly conserved

622Amostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes8

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa bostoniensissame genus2.1%Euxoa sculptilissame genus3.6%Euxoa xastasame genus4.1%Euxoa foeminalissame genus4.6%Euxoa dodisame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type255 records

Wild obs. + sensor40

Museum / vouchered215

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 17≤1 km 2≤10 km 10>10 km 6

35 georeferenced · 5 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 38≤1 km 34≤10 km 38>10 km 32

142 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence215

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	118
University of Alberta Museums (UAM)location not on record	41
Denver, US	14
ASUlocation not on record	7
Ciudad de México, MX	6
San Diego, US	6
East Lansing, US	6
New Haven, US	2
San Francisco, US	2
Awka, NG	2
King Saud Universitylocation not on record	2
Albuquerque, US	1

12 institutions · 207 of 215 vouchered records shown · 8 without an institution code

09Environmental DNA15 detections

Where the DNA of Euxoa medialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 5.90–23.4

Seasonal swing summer↔winter18.6 °C

Max temp (day)18.9 °C 10.9–28.9

Min temp (night)7.20 °C 2.20–18.8

Precipitation59.1 mm/mo 28.8–118

Air humidity53.7 % 46.3–58.7

Moisture balance-41.1 mm/mo -68.8–78.3

Vapour deficit699 Pa 395–1,267

Wind speed2.40 m/s 1.40–3.60

Cloud cover28.2 % 22.6–52.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)