Euxoa intrita

Morrison, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records353

Data sources7

Biological traits0

DNA specimens18

eDNA detections17

Sources7 archives

Databases and archives Euxoa intrita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF353 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD18 specimens

01Narrative

Euxoa intrita is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa intrita is 10749.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa intrita has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

34Amostly conserved

49Tmostly conserved

274Cmostly conserved

403Amostly conserved

595Tmostly conserved

607Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa foeminalissame genus2.1%Euxoa inyocasame genus2.1%Euxoa costatasame genus2.1%Euxoa brunneigerasame genus2.1%Euxoa oblongistigmasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type353 records

Wild obs. + sensor17

Museum / vouchered336

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 4≤1 km 6≤10 km 6

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 22≤1 km 9≤10 km 13>10 km 2

46 georeferenced · 290 without coordinates

Open the institutions mapphysical evidence336

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	97
Oregon State Arthropod Collectionlocation not on record	85
Vernal, US	44
Colorado State Universitylocation not on record	26
Royal Saskatchewan Museumlocation not on record	19
St. Paul, US	15
New Haven, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Champaign, US	5
East Lansing, US	4
WWUlocation not on record	3
Natural History Museum of Utahlocation not on record	1
ASUlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

14 institutions · 321 of 336 vouchered records shown · 15 without an institution code

09Environmental DNA17 detections

Where the DNA of Euxoa intrita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 2.80–18.3

Seasonal swing summer↔winter26.5 °C

Max temp (day)22.9 °C 8.10–25.5

Min temp (night)8.50 °C -2.00–13.2

Precipitation46.7 mm/mo 28.7–73.6

Air humidity54.6 % 49.8–60.7

Moisture balance-57.8 mm/mo -93.6–12.3

Vapour deficit871 Pa 315–1,041

Wind speed2.20 m/s 1.80–4.10

Cloud cover40.8 % 33.9–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)