Euxoa divergens

Walker, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records1 421

Data sources7

Biological traits0

DNA specimens128

eDNA detections143

Sources7 archives

Databases and archives Euxoa divergens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics128 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 421 records

Environmental DNA1 datasets · 2 countries143 detections

DNA & barcodingBOLD128 specimens

01Narrative

Euxoa divergens, the divergent dart, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1857. It is found in North America from Newfoundland to Alaska, south to New York and Michigan in the east, and in the mountains of the west, south to New Mexico, Arizona and California. The wingspan is 31–35 mm. Adults are on wing from May to September. There is one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding128 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa divergens has left across the world's sequence archives.

At a glance

DNA specimens128

BINs2

Marker genes1

eDNA detections143

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus121 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

40Tmostly conserved

43Avariable

59Tmostly conserved

73Avariable

97Tmostly conserved

220Tmostly conserved

268Tmostly conserved

364Tvariable

400Cmostly conserved

484Tmostly conserved

512Gvariable

514Tmostly conserved

517Amostly conserved

547Tvariable

634Cmostly conserved

646Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes11

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa lewisisame genus2.0%Euxoa obeliscasame genus2.1%Euxoa maimessame genus2.1%Euxoa mendelissame genus2.1%Euxoa occidentalissame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 421 records

Wild obs. + sensor145

Museum / vouchered1 276

Range

Area of Occupancy AOO2 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 85≤1 km 17≤10 km 23>10 km 5

130 georeferenced · 15 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 160≤1 km 91≤10 km 207>10 km 92

550 georeferenced · 726 without coordinates

Open the institutions mapphysical evidence1 276

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	294
University of Alberta Museums (UAM)location not on record	240
New Haven, US	197
East Lansing, US	73
Royal Saskatchewan Museumlocation not on record	72
Oregon State Arthropod Collectionlocation not on record	52
Vernal, US	45
St. Paul, US	39
University of Guelph, Centre for Biodiversity Genomicslocation not on record	37
ASUlocation not on record	28
Cleveland Museum of Natural History, OH (CLEV)location not on record	25
Helsinki, FI	23
US	11
Brussels, BE	9
RBINS-Scientific Heritagelocation not on record	7
WWUlocation not on record	3
Natural History Museum of Utahlocation not on record	2
Albuquerque, US	2
Philadelphia, US	2
KWPlocation not on record	1
Mississippi State, US	1
San Francisco, US	1
Denver, US	1
Toronto, CA	1

24 institutions · 1 166 of 1 276 vouchered records shown · 110 without an institution code

09Environmental DNA143 detections

Where the DNA of Euxoa divergens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map2 countries0

ForestWetlandGrasslandMixed HabitatMixed habitat4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 11.6–20.2

Seasonal swing summer↔winter26.5 °C

Max temp (day)23.1 °C 17.6–26.7

Min temp (night)11.2 °C 4.80–14.2

Precipitation53.4 mm/mo 28.7–111

Air humidity52.8 % 49.8–60.0

Moisture balance-78.6 mm/mo -119–-14.3

Vapour deficit897 Pa 643–1,113

Wind speed2.60 m/s 1.70–3.80

Cloud cover37.3 % 33.3–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 130 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa divergens

At a glance

Sources7 archives

At a glance

Record type1 421 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 421 records