Euxoa difformis

Smith, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records286

Data sources7

Biological traits0

DNA specimens38

eDNA detections37

Sources7 archives

Databases and archives Euxoa difformis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF286 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD38 specimens

01Narrative

Euxoa difformis is a cutworm or dart moth in the family Noctuidae. The species was first described by Smith in 1900. It is found in North America. The MONA or Hodges number for Euxoa difformis is 10845.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa difformis has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

49Tmostly conserved

172Tmostly conserved

316Gmostly conserved

479Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes10

BINs2

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa murdockisame genus2.9%Euxoa dargosame genus3.0%Euxoa velleripennissame genus3.0%Euxoa plagigerasame genus3.0%Euxoa cinereopallidussame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type286 records

Wild obs. + sensor7

Museum / vouchered279

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 2≤1 km 1≤10 km 4

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 19≤1 km 31≤10 km 23>10 km 8

81 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	72
Oregon State Arthropod Collectionlocation not on record	68
San Diego, US	56
Colorado State Universitylocation not on record	21
Vernal, US	10
New Haven, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
WWUlocation not on record	3
Essig Museum of Entomologylocation not on record	1
East Lansing, US	1

10 institutions · 243 of 279 vouchered records shown · 36 without an institution code

09Environmental DNA37 detections

Where the DNA of Euxoa difformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 12.9–16.6

Seasonal swing summer↔winter13.1 °C

Max temp (day)21.0 °C 17.1–24.1

Min temp (night)13.2 °C 10.1–13.2

Precipitation29.0 mm/mo 18.2–66.7

Air humidity59.4 % 50.0–60.6

Moisture balance-91.6 mm/mo -91.6–18.5

Vapour deficit747 Pa 585–1,006

Wind speed1.90 m/s 1.50–2.50

Cloud cover31.6 % 31.0–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)