Euxoa detersa

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records974

Data sources6

Biological traits0

DNA specimens21

eDNA detections0

Sources6 archives

Databases and archives Euxoa detersa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility974 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF974 records

DNA & barcodingBOLD21 specimens

01Narrative

Euxoa detersa, the rubbed dart, sandhill cutworm or sand cutworm, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1856. It is found in North America from Newfoundland to North Carolina, west to Nebraska, north to Alberta and the Northwest Territories. The wingspan is 30–35 mm. Adults are on wing from July to October. There is one generation per year. The larvae feed on corn, various grasses, cranberry, saltwort, sea-rocket, various garden crops and commercial grains. The larvae construct burrows to feed on underground portions of host plants. They are considered very destructive in fields planted in sandy soils.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa detersa has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

5Tmostly conserved

34Amostly conserved

40Cmostly conserved

49Cmostly conserved

59Tmostly conserved

85Amostly conserved

92Cmostly conserved

118Cmostly conserved

217Amostly conserved

220Tmostly conserved

229Gvariable

235Tmostly conserved

268Cmostly conserved

274Tmostly conserved

283Cmostly conserved

290Gmostly conserved

349Tmostly conserved

361Tmostly conserved

364Cmostly conserved

477Amostly conserved

478Tvariable

487Tmostly conserved

506Gmostly conserved

508Amostly conserved

547Amostly conserved

553Tmostly conserved

556Tmostly conserved

596Cmostly conserved

610Tmostly conserved

616Cmostly conserved

619Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTCGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa atristrigatasame genus2.3%Euxoa nevadasame genus2.4%Euxoa hollemanisame genus2.6%Euxoa melanasame genus2.7%Euxoa glabellasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type974 records

Wild obs. + sensor328

Museum / vouchered646

Range

Area of Occupancy AOO1 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 210≤1 km 62≤10 km 15>10 km 3

290 georeferenced · 38 without coordinates

Open the mapobservation + sensor328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 21≤1 km 105≤10 km 222>10 km 30

378 georeferenced · 268 without coordinates

Open the institutions mapphysical evidence646

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	234
New Haven, US	108
University of Alberta Museums (UAM)location not on record	101
St. Paul, US	77
Royal Saskatchewan Museumlocation not on record	32
ASUlocation not on record	20
Cornell University Insect Collectionlocation not on record	16
UNHClocation not on record	16
Helsinki, FI	13
King Saud Universitylocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Philadelphia, US	2
Toronto, CA	2
UDlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Colorado State Universitylocation not on record	1

16 institutions · 637 of 646 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)