Euxoa decora

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records1 855

Data sources7

Biological traits0

DNA specimens35

eDNA detections35

Sources7 archives

Databases and archives Euxoa decora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 855 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 855 records

Environmental DNA1 datasets · 7 countries35 detections

DNA & barcodingBOLD35 specimens

01Narrative

Euxoa decora is a moth of the family Noctuidae. It is found in southern and central Europe, Morocco, Algeria, the Caucasus, Armenia, Issyk-Kul, Turkey, Iran and Iraq. Illustration It has a typical wingspan of 38–41 mm. Each generation of adults are on wing from July to September, and larvae feed on a wide range of low growing plants, including Anthyllis vulneraria.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa decora has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections35

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

5Cmostly conserved

88Gmostly conserved

235Cmostly conserved

250Tmostly conserved

364Tmostly conserved

394Tmostly conserved

466Gmostly conserved

500Tmostly conserved

547Tmostly conserved

625Amostly conserved

646Tvariable

AACACTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes10

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa mustelinasame genus1.7%Euxoa flavicollissame genus1.8%Euxoa christophisame genus1.8%Euxoa obeliscasame genus2.0%Euxoa occidentalissame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 855 records

Wild obs. + sensor1 133

Museum / vouchered464

Other258

Range

Area of Occupancy AOO2 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 666≤1 km 219≤10 km 131>10 km 9

1 025 georeferenced · 108 without coordinates

Open the mapobservation + sensor1 133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 68≤1 km 99≤10 km 176>10 km 1

344 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence464

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	199
Helsinki, FI	140
Zürich, CH	37
UMUlocation not on record	29
Provincia di Livornolocation not on record	19
Adam Mickiewicz University in Poznańlocation not on record	13
European Distributed Institute of Taxonomy (EDIT)location not on record	7
Tartu, EE	3
ZSMlocation not on record	2
John May Museum of Natural Historylocation not on record	1
National Museums of Kenyalocation not on record	1
NHMOlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

13 institutions · 453 of 464 vouchered records shown · 11 without an institution code

09Environmental DNA35 detections

Where the DNA of Euxoa decora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 8.40–17.4

Seasonal swing summer↔winter19.4 °C

Max temp (day)17.6 °C 12.8–21.5

Min temp (night)7.50 °C 1.90–11.4

Precipitation89.4 mm/mo 49.6–202

Air humidity59.5 % 55.5–64.8

Moisture balance-19.8 mm/mo -78.0–103

Vapour deficit632 Pa 419–841

Wind speed2.70 m/s 1.50–5.40

Cloud cover36.5 % 33.9–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa decora

At a glance

Sources7 archives

At a glance

Record type1 855 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 855 records