Euxoa cursoria

Hufnagel, 1766 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records8 348

Data sources7

Biological traits2

DNA specimens27

eDNA detections48

Sources7 archives

Databases and archives Euxoa cursoria's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 348 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 348 records

Environmental DNA1 datasets · 3 countries48 detections

DNA & barcodingBOLD27 specimens

01Narrative

Euxoa cursoria, the coast dart, is a moth of the family Noctuidae. It is found in northern and central Europe as well as the coastal regions of the British Isles, central Siberia, Mongolia, Tibet and Afghanistan. The subspecies Euxoa cursoria wirima is found in Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa cursoria has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections48

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

133Cmostly conserved

166Gmostly conserved

628Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes4

BIN1

Most divergent pair0.30%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa phantomasame genus1.8%Euxoa simonasame genus2.7%Euxoa tristissame genus2.7%Euxoa pleuriticasame genus2.7%Euxoa terrealissame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 348 records

Wild obs. + sensor6 134

Museum / vouchered2 213

Other1

Origin

Native226

Range

Area of Occupancy AOO5 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 1 678≤1 km 1 177≤10 km 3 107>10 km 25

5 987 georeferenced · 147 without coordinates

Open the mapobservation + sensor6 134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 756≤1 km 357≤10 km 619>10 km 39

1 771 georeferenced · 442 without coordinates

Open the institutions mapphysical evidence2 213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	702
Helsinki, FI	686
NTNU-VMlocation not on record	190
Tartu, EE	122
NHMOlocation not on record	65
ZMAAlocation not on record	39
Tallinn, EE	38
Philadelphia, US	29
SLU Artdatabankenlocation not on record	24
University of Alberta Museums (UAM)location not on record	21
Kuopio, FI	16
Natural History Museum Rotterdamlocation not on record	16
Durban Natural Science Museumlocation not on record	15
Zürich, CH	13
Podgorica, ME	13
Metsähallituslocation not on record	13
CBDClocation not on record	9
Muzeum Górnośląskie w Bytomiulocation not on record	8
MZLUlocation not on record	7
DABUHlocation not on record	4
Provincia di Livornolocation not on record	3
Research Collection of Kai Berggrenlocation not on record	3
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
Nijmegen, NL	1
ZSMlocation not on record	1

27 institutions · 2 043 of 2 213 vouchered records shown · 170 without an institution code

09Environmental DNA48 detections

Where the DNA of Euxoa cursoria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map3 countries0

Forest1. Forest & Woodlandindoors - Earth Sci. labMixed HabitatMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 6.70–17.4

Seasonal swing summer↔winter28.7 °C

Max temp (day)21.2 °C 12.3–22.7

Min temp (night)11.4 °C 1.60–13.1

Precipitation70.7 mm/mo 41.8–99.8

Air humidity57.7 % 55.6–61.6

Moisture balance-15.9 mm/mo -59.9–16.2

Vapour deficit723 Pa 410–898

Wind speed2.20 m/s 1.30–3.60

Cloud cover47.8 % 34.0–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa cursoria

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type8 348 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 348 records