Euxoa cos

Hübner · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records1 157

Data sources6

Biological traits0

DNA specimens24

eDNA detections23

Sources6 archives

Databases and archives Euxoa cos's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 157 records

Environmental DNA1 datasets · 5 countries23 detections

DNA & barcodingBOLD24 specimens

01Narrative

Euxoa cos is a moth of the family Noctuidae. It is found in southern Europe, the Near East and Middle East. Adults are on wing in September to October. There is one generation per year. The larvae feed partly subterraneous on various herbaceous plants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa cos has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections23

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

187Cmostly conserved

211Amostly conserved

235Cmostly conserved

337Gmostly conserved

477Gmostly conserved

610Cmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes9

BINs2

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa triticisame genus2.0%Euxoa nigrofuscasame genus2.0%Euxoa erutasame genus2.0%Euxoa mendelissame genus2.1%Euxoa diaphorasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 157 records

Wild obs. + sensor436

Museum / vouchered569

Other152

Origin

Native412

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 17≤1 km 25≤10 km 371>10 km 2

415 georeferenced · 21 without coordinates

Open the mapobservation + sensor436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 34≤10 km 430>10 km 2

466 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence569

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	58
Bern, CH	50
UMUlocation not on record	36
SFRAlocation not on record	34
Sion, CH	32
Zürich, CH	32
Musee d'Histoire Naturallelocation not on record	28
Provincia di Livornolocation not on record	25
Geneva, CH	15
Fribourg, CH	14
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	7
Frauenfeld, CH	7
Archäologie und Museum Baselland - Museum.BLlocation not on record	6
Glarus, CH	5
John May Museum of Natural Historylocation not on record	4
Winterthur, CH	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
EGBlocation not on record	2
ZSMlocation not on record	1
Philadelphia, US	1

20 institutions · 362 of 569 vouchered records shown · 207 without an institution code

09Environmental DNA23 detections

Where the DNA of Euxoa cos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 12.3–20.0

Seasonal swing summer↔winter16.3 °C

Max temp (day)21.4 °C 16.6–24.9

Min temp (night)12.2 °C 7.00–15.3

Precipitation71.2 mm/mo 26.8–94.9

Air humidity57.4 % 51.5–59.6

Moisture balance-47.0 mm/mo -122–9.20

Vapour deficit915 Pa 568–1,114

Wind speed2.40 m/s 2.10–4.90

Cloud cover34.8 % 24.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa cos

At a glance

Sources6 archives

At a glance

Record type1 157 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 157 records