Euxoa birivia

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records1 004

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Euxoa birivia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 004 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 004 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Euxoa birivia is a moth of the family Noctuidae. It is found in Europe (France, Italy, Germany, Switzerland, Austria, Poland, Czech Republic, Slovakia, Hungary, Romania, Albania, Slovenia, Bosnia and Herzegovina, Bulgaria and Croatia), east to Ukraine, the Caucasus, Armenia, central Asia, Ili, Issyk-Kul, Turkey and Iran. The wingspan is 34–41 mm. Adults are on wing from mid July to the end of August. There is one generation per year. The larvae probably feed on the roots of various grass species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa birivia has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 26 variable positions, in barcode order

2Amostly conserved

82Cmostly conserved

85Tmostly conserved

106Cmostly conserved

124Tmostly conserved

136Cmostly conserved

196Gmostly conserved

200Amostly conserved

229Gmostly conserved

268Tmostly conserved

343Cmostly conserved

361Cmostly conserved

415Amostly conserved

469Amostly conserved

487Cmostly conserved

490Tmostly conserved

505Tmostly conserved

508Cmostly conserved

547Tmostly conserved

550Tmostly conserved

553Tmostly conserved

556Tmostly conserved

568Cmostly conserved

628Amostly conserved

634Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa flavidenssame genus2.9%Euxoa temerasame genus3.0%Euxoa occidentalissame genus3.2%Euxoa hastiferasame genus3.2%Euxoa zernyisame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 004 records

Wild obs. + sensor288

Museum / vouchered573

Other143

Origin

Native258

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 47≤1 km 78≤10 km 150>10 km 2

277 georeferenced · 11 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 7≤1 km 171≤10 km 359>10 km 9

546 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence573

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	120
Zürich, CH	73
Bern, CH	39
Geneva, CH	35
Salzburg, AT	34
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	32
Dhaka, BD	22
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	21
SFRAlocation not on record	20
Muzeum Górnośląskie w Bytomiulocation not on record	19
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	16
Musee d'Histoire Naturallelocation not on record	14
Naturmuseum St. Gallenlocation not on record	13
Sion, CH	11
Glarus, CH	9
Frauenfeld, CH	8
Archäologie und Museum Baselland - Museum.BLlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	5
Fribourg, CH	4
Tartu, EE	4
Winterthur, CH	3
Uniwersytet Łódzkilocation not on record	3
Naturama Aargaulocation not on record	2
Naturmuseum Oltenlocation not on record	2
EGBlocation not on record	2

25 institutions · 517 of 573 vouchered records shown · 56 without an institution code

09Environmental DNA5 detections

Where the DNA of Euxoa birivia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 7.60–16.0

Seasonal swing summer↔winter19.6 °C

Max temp (day)17.4 °C 12.0–20.4

Min temp (night)7.80 °C 1.70–10.9

Precipitation196 mm/mo 134–199

Air humidity62.0 % 57.9–62.5

Moisture balance89.8 mm/mo 16.6–101

Vapour deficit578 Pa 427–684

Wind speed2.30 m/s 1.60–5.20

Cloud cover37.0 % 36.6–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa birivia

At a glance

Sources7 archives

At a glance

Record type1 004 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 004 records