Euwallacea validus

Wood & Bright, 1992 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Euwallacea

At a glance

Occurrence records210

Data sources4

Biological traits0

DNA specimens37

eDNA detections37

Sources4 archives

Databases and archives Euwallacea validus's data was compiled from.

GBIFGlobal Biodiversity Information Facility210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF210 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD37 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euwallacea validus has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes2

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P661 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

1Avariable

AACTCTATATTTCATCTTTGGTGCATGAGCAGGTATAGTAGGAACCTCTCTTAGAGTTCTAATTCGAACTGAACTAGGAACACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BIN1

Most divergent pair0.45%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euwallacea andamanensissame genus14.1%Euwallacea destruenssame genus14.1%Euwallacea kuroshiosame genus14.2%Xylosandrus compactussame family14.6%Coccotrypes longiorsame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type210 records

Wild obs. + sensor45

Museum / vouchered165

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 18≤1 km 7>10 km 5

30 georeferenced · 15 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	156
OSUClocation not on record	4
Helsinki, FI	2
Ciudad de México, MX	1

4 institutions · 163 of 165 vouchered records shown · 1 without an institution code

09Environmental DNA37 detections

Where the DNA of Euwallacea validus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 7.40–16.8

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 9.60–22.1

Min temp (night)8.20 °C 3.00–11.5

Precipitation79.6 mm/mo 79.6–344

Air humidity57.3 % 57.3–64.9

Moisture balance-38.4 mm/mo -38.4–263

Vapour deficit733 Pa 428–799

Wind speed5.80 m/s 2.50–5.80

Cloud cover36.7 % 36.7–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)