Euwallacea interjectus

Wood & Bright, 1992 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Euwallacea

At a glance

Occurrence records154

Data sources4

Biological traits0

DNA specimens115

eDNA detections103

Sources4 archives

Databases and archives Euwallacea interjectus's data was compiled from.

GBIFGlobal Biodiversity Information Facility154 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF154 records

Environmental DNA1 datasets · 7 countries103 detections

DNA & barcodingBOLD115 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euwallacea interjectus has left across the world's sequence archives.

At a glance

DNA specimens115

BINs13

Marker genes4

eDNA detections103

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 117 variable positions, in barcode order

1Cmostly conserved

7Amostly conserved

22Amostly conserved

34Cmostly conserved

40Tmostly conserved

52Amostly conserved

58Cmostly conserved

64Tmostly conserved

67Tmostly conserved

70Cmostly conserved

73Amostly conserved

82Amostly conserved

85Tmostly conserved

92Tmostly conserved

97Cmostly conserved

100Amostly conserved

106Cmostly conserved

112Cmostly conserved

118Cmostly conserved

121Tmostly conserved

127Amostly conserved

133Cmostly conserved

139Cmostly conserved

145Cmostly conserved

151Cmostly conserved

154Tmostly conserved

160Gmostly conserved

181Amostly conserved

184Tmostly conserved

187Tmostly conserved

190Amostly conserved

196Amostly conserved

197Tmostly conserved

202Cmostly conserved

205Cmostly conserved

206Cmostly conserved

217Gmostly conserved

220Tvariable

223Amostly conserved

235Cmostly conserved

238Tmostly conserved

241Amostly conserved

244Cmostly conserved

247Cmostly conserved

250Cmostly conserved

262Gmostly conserved

271Amostly conserved

274Tmostly conserved

277Amostly conserved

278Tmostly conserved

283Cmostly conserved

286Tmostly conserved

298Amostly conserved

305Amostly conserved

307Tmostly conserved

316Amostly conserved

328Gmostly conserved

337Amostly conserved

340Tmostly conserved

343Cvariable

352Cvariable

355Tmostly conserved

358Cmostly conserved

364Cmostly conserved

370Amostly conserved

376Tmostly conserved

382Cmostly conserved

385Cmostly conserved

388Gmostly conserved

394Tmostly conserved

397Cmostly conserved

403Amostly conserved

415Amostly conserved

421Tmostly conserved

424Tmostly conserved

427Cmostly conserved

433Amostly conserved

442Cmostly conserved

454Cmostly conserved

457Tmostly conserved

460Tmostly conserved

469Cmostly conserved

472Cmostly conserved

478Tmostly conserved

487Tmostly conserved

499Tmostly conserved

500Cmostly conserved

517Cmostly conserved

523Cmostly conserved

526Tmostly conserved

532Cmostly conserved

533Tmostly conserved

535Amostly conserved

541Tmostly conserved

542Cmostly conserved

544Amostly conserved

550Amostly conserved

556Tmostly conserved

557Tmostly conserved

562Amostly conserved

565Amostly conserved

581Cmostly conserved

586Tmostly conserved

589Tmostly conserved

592Amostly conserved

598Tmostly conserved

604Tmostly conserved

610Cmostly conserved

613Tmostly conserved

616Cmostly conserved

625Gmostly conserved

628Amostly conserved

631Amostly conserved

634Cmostly conserved

640Tmostly conserved

643Cmostly conserved

652Cmostly conserved

CACTCTATATTTTATTTTTGGAGCATGAGCAGGCATAGTTGGAACATCTCTAAGAGTCCTAATTCGTACCGAACTAGGAACACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 41 variants.

Diversity (π)3.8%

Haplotypes41

BINs13

Most divergent pair16.4%

AsiaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xylosandrus compactussame family14.6%Xyleborinus bicornatulussame family15.0%Euwallacea fornicatussame genus15.1%Xylosandrus derupteterminatussame family15.4%Xyleborus cryptographussame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069051 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type154 records

Wild obs. + sensor5

Museum / vouchered149

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2>10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 149 records without

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	1

2 institutions · 4 of 149 vouchered records shown · 144 without an institution code

09Environmental DNA103 detections

Where the DNA of Euwallacea interjectus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 12.5–28.2

Seasonal swing summer↔winter22.0 °C

Max temp (day)27.5 °C 18.4–31.2

Min temp (night)20.8 °C 8.20–24.8

Precipitation164 mm/mo 79.6–266

Air humidity64.9 % 57.3–69.8

Moisture balance21.8 mm/mo -45.7–108

Vapour deficit1,022 Pa 733–1,323

Wind speed3.20 m/s 1.70–5.80

Cloud cover39.4 % 35.6–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)