Euura tibialis

(Newman, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Euura

At a glance

Occurrence records581

Data sources4

Biological traits0

DNA specimens35

eDNA detections34

Sources4 archives

Databases and archives Euura tibialis's data was compiled from.

GBIFGlobal Biodiversity Information Facility581 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF581 records

Environmental DNA2 datasets · 9 countries34 detections

DNA & barcodingBOLD35 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euura tibialis has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections34

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 60 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

44Cmostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

56Amostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Cmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

80Amostly conserved

81Tmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Tmostly conserved

90Cmostly conserved

91Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

99Gmostly conserved

109Gmostly conserved

217Gmostly conserved

322Gmostly conserved

340Tmostly conserved

346Tvariable

401Cmostly conserved

470Cvariable

565Gmostly conserved

616Cmostly conserved

622Cvariable

646Cmostly conserved

AACATTATATTTTATTTTAGGTTTTTGATCTGGAATATTAGGCCTATCATTTAGAATATTAATTCGAACAGAACTTGGTATACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euura leptostigmasame genus8.0%Euura fuscomaculatasame genus8.0%Euura polarissame genus8.1%Euura lipovskyisame genus8.1%Euura dissimilissame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type581 records

Wild obs. + sensor565

Museum / vouchered16

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 238≤1 km 107≤10 km 15>10 km 14

374 georeferenced · 191 without coordinates

Open the mapobservation + sensor565

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 5≤10 km 3

8 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Zoology Slovak Academy of Scienceslocation not on record	5
Philadelphia, US	2
Bavarian State Collection of Zoologylocation not on record	2
South Kensington, GB	2
ZSMlocation not on record	1

5 institutions · 12 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA34 detections

Where the DNA of Euura tibialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys2

Countries9

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map9 countries0

1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial | 14.2 Pasturel…14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 12.1–21.7

Seasonal swing summer↔winter19.7 °C

Max temp (day)21.0 °C 15.7–27.0

Min temp (night)12.7 °C 6.80–17.8

Precipitation92.3 mm/mo 56.7–120

Air humidity60.2 % 56.8–62.9

Moisture balance-33.4 mm/mo -56.9–39.2

Vapour deficit762 Pa 542–1,063

Wind speed2.80 m/s 1.90–3.80

Cloud cover37.7 % 32.2–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)