Eutypella parasitica

R.W.Davidson & R.C.Lorenz · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Diatrypaceae/Eutypella

At a glance

Occurrence records668

Data sources8

Biological traits0

DNA specimens19

eDNA detections19

Sources8 archives

Databases and archives Eutypella parasitica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility668 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF668 records

Environmental DNA3 datasets · 3 countries19 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Eutypella canker is a plant disease caused by the fungal pathogen Eutypella parasitica. This disease is capable of infecting many species of maple trees and produces a large, distinguishable canker on the main trunk of the tree. Infection and spread of the disease is accomplished with the release of ascospores from perithecia. Therefore, the best way to manage the Eutypella canker is to remove trees that have been infected. If infected, it can decrease the quality of wood cut for lumber and can thus have a negative economic impact.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutypella parasitica has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes2

GenBank sequences10

eDNA detections19

Countries5

The DNA barcodea real sequence read deposited for this species

ITSOQ451831.1 ↗301 bpSwitzerland · 2003

ACGT

TGAGTTATTATACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA …

Eutypella parasitica voucher ZTMyc_1740 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type668 records

Wild obs. + sensor558

Museum / vouchered110

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 165≤1 km 247≤10 km 15>10 km 1

428 georeferenced · 130 without coordinates

Open the mapobservation + sensor558

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 4≤1 km 5≤10 km 76>10 km 5

90 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Slovenian Forestry Institutelocation not on record	52
Bernard Price Institute for Palaeontological Researchlocation not on record	14
Catholic University of Pekinglocation not on record	8
Toronto, CA	7
Pullman, US	4
Université de Montréal Biodiversity Centrelocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
Bronx, US	1
CA	1
Ann Arbor, US	1
Chicago, US	1
McWane Science Centerlocation not on record	1
Madison, US	1
St. Paul, US	1

14 institutions · 96 of 110 vouchered records shown · 3 without an institution code

09Environmental DNA19 detections

Where the DNA of Eutypella parasitica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys3

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 8.80–10.5

Seasonal swing summer↔winter20.5 °C

Max temp (day)14.3 °C 12.6–14.3

Min temp (night)5.50 °C 4.90–5.50

Precipitation100 mm/mo 96.5–101

Air humidity61.8 % 61.8–66.7

Moisture balance22.7 mm/mo 22.7–37.0

Vapour deficit543 Pa 380–543

Wind speed2.50 m/s 2.50–3.70

Cloud cover44.9 % 44.1–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)