Eutropiichthys vacha

(Hamilton, 1822) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Schilbeidae/Eutropiichthys

At a glance

Occurrence records74

Data sources10

Biological traits7

DNA specimens51

eDNA detections56

Sources10 archives

Databases and archives Eutropiichthys vacha's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

OBISOcean Biodiversity Information System16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS74 records

Environmental DNA1 datasets · 3 countries56 detections

DNA & barcodingBOLD51 specimens

01Narrative

Eutropiichthys vacha is a species of schilbid catfish native to India, Nepal, Bhutan, and Bangladesh.Bailly, N. (2015). Eutropiichthys vacha. In: Froese, R. and D. Pauly. Editors. (2015) FishBase. Accessed through: World Register of Marine Species at http://marinespecies.org/aphia.php?p=taxdetails&id=280759 on 2016-05-23Ng, H.H. 2010. Eutropiichthys vacha. In: IUCN 2014 . IUCN Red List of Threatened Species. Version 2014.1 . It can reach a length of 34 cm, and a mass of 1.35 kg. Eutropiichthys vacha is a climate sensitive species that may be selected as a target species for climate change impact studies. Region-specific adaptation was noticed in breeding phenology of this schilbid catfish in River Ganga, based on local trends of warming climate. A threshold water temperature around 24 °C and rainfall of > 100 mm were found to be necessary for attainment of breeding GSI (> 3.5 units) in E. vacha. It appears that warming climate may have the most profound effect on gonad maturation and spawning in E. vacha.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length38.2 cm

Body mass1 350 g

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability20.05

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutropiichthys vacha has left across the world's sequence archives.

At a glance

DNA specimens51

BINs4

Marker genes1

eDNA detections56

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

4Gmostly conserved

10Gmostly conserved

29Gmostly conserved

31Tmostly conserved

55Gmostly conserved

86Gmostly conserved

88Amostly conserved

94Amostly conserved

121Cmostly conserved

130Tmostly conserved

142Tmostly conserved

178Gmostly conserved

196Tmostly conserved

199Cmostly conserved

205Gmostly conserved

235Cmostly conserved

259Gmostly conserved

260Cmostly conserved

262Gmostly conserved

268Tmostly conserved

271Gmostly conserved

274Cmostly conserved

295Gmostly conserved

313Gmostly conserved

346Amostly conserved

373Cmostly conserved

382Cmostly conserved

388Cmostly conserved

397Tmostly conserved

400Amostly conserved

403Tmostly conserved

409Cmostly conserved

412Amostly conserved

421Tmostly conserved

436Cmostly conserved

475Tmostly conserved

484Amostly conserved

496Amostly conserved

529Tmostly conserved

535Gmostly conserved

544Cmostly conserved

553Gmostly conserved

575Tmostly conserved

578Tmostly conserved

598Cmostly conserved

610Tmostly conserved

616Amostly conserved

625Gmostly conserved

631Cmostly conserved

634Tmostly conserved

637Cmostly conserved

640Cmostly conserved

643Cmostly conserved

649Tmostly conserved

652Tmostly conserved

CCTGTATTTGGTATTTGGTGCCTGAGCCGGTATAGTTGGCACAGCCCTTAGCCTGCTAATTCGGGCAGAACTAGCCCAACCTGGTGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes4

BINs4

Most divergent pair15.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Clupisoma bastarisame family9.2%Silonia childrenisame family9.6%Clupisoma praterisame family9.7%Clupisoma garuasame family9.8%Silonia silondiasame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~30.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin30.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type74 records

Wild obs. + sensor6

Museum / vouchered68

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1>10 km 2

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 13

19 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	6
Ann Arbor, US	6
CASlocation not on record	5
Cambridge, US	3
Montgomery, US	2
FishBaselocation not on record	1
Stockholm, SE	1
	1
Frankfurt am Main	1
Chicago, US	1

10 institutions · 27 of 68 vouchered records shown · 28 without an institution code

09Environmental DNA56 detections

Where the DNA of Eutropiichthys vacha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map3 countries0

freshwater wetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 17.1–27.6

Seasonal swing summer↔winter12.0 °C

Max temp (day)30.2 °C 19.8–31.2

Min temp (night)19.5 °C 12.9–24.6

Precipitation75.7 mm/mo 37.3–424

Air humidity60.9 % 53.9–67.4

Moisture balance-58.1 mm/mo -70.6–286

Vapour deficit1,230 Pa 734–1,590

Wind speed2.20 m/s 0.8–2.60

Cloud cover35.6 % 23.5–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)