Eutrochium dubium

(Willd. ex Poir.) E.E.Lamont · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eutrochium

At a glance

Occurrence records1 559

Data sources11

Biological traits7

DNA specimens6

eDNA detections3

Sources11 archives

Databases and archives Eutrochium dubium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF1 559 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eutrochium dubium, also called coastal plain joe pye weed, is a North American flowering plant in the family Asteraceae. It is native to the eastern United States and Canada, primarily the Atlantic coastal plain from Georgia to Nova Scotia. Eutrochium dubium is a herbaceous perennial plant herb sometimes as much as 170 cm (68 inches or 5 2/3 feet) tall. Stems are sometimes purple, sometimes green with purple spots. The plant produces numerous flower heads in flat-topped arrays, each head has 4-10 dark purple (rarely pink or white) disc florets but no ray florets. The flowers are attractive to birds. Eutrochium dubium prefers full sun to part shade. It will grow in a variety of soil types, provided the soil does not dry out.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutrochium dubium has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF177839.1 ↗227 bpUSA

ACGT

ATCACGTCGCCCACATCAAACATCCTTGTTTGGATTCCAATGTGTGTGGGCGGAGACTGGTCTCCTGTGCCCATGGTGGTGCGGTTGGCC …

Eupatoriadelphus dubius specimen-voucher E.E. Schilling #95-4 internal transcribed spacer 2 ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eutrochium dubium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Watanabe, K., M. Ito, T. Yahara, V. I. Sullivan, T. Kawahara & D. J. Crawford. 1990. Numerical analyses of karyotype diversity in the genus Eupatorium (Compositae, Eupatorieae). Pl. Syst. Evol. 170: 215–228.

CCDB · ipcn-api-dl — Lamont, E. E. 1995. Taxonomy of Eupatorium section Verticillata (Asteraceae). Mem. New York Bot. Gard. 72: 1–68.

CCDB · eflora

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 559 records

Wild obs. + sensor1 205

Museum / vouchered354

Range

Area of Occupancy AOO4 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 793≤1 km 96≤10 km 54>10 km 65

1 008 georeferenced · 197 without coordinates

Open the mapobservation + sensor1 205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 9≤1 km 28≤10 km 110>10 km 103

250 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence354

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bangkok, TH	82
University of New Hampshirelocation not on record	32
Chongqing Museumlocation not on record	22
Philadelphia, US	18
University of Stellenboschlocation not on record	9
Burlington, US	8
Norfolk, US	7
College Park, US	7
Columbia, US	7
Chapel Hill, US	4
Weymouth Woods Sandhills Nature Preservelocation not on record	4
Bronx, US	4
University of South Carolina Salkehatchielocation not on record	4
Bloomington, US	3
Williamsburg, US	3
Wuzhou, CN	3
Millersville, US	3
Clemson, US	2
Cambridge, US	2
Acadia Universitylocation not on record	2
New Brunswick, US	2
Hudson, US	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Durham, US	1
Fairfax, US	1
Pittsburg, US	1
Wlocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Baltimore, US	1
Denver, US	1
Dekalb, US	1
Riverside, US	1

32 institutions · 240 of 354 vouchered records shown · 114 without an institution code

09Environmental DNA3 detections

Where the DNA of Eutrochium dubium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

fresh-water marshalong water-course in wet open ground

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eutrochium dubium

At a glance

Sources11 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 559 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 559 records