Eutricopis nexilis

Morrison, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Eutricopis

At a glance

Occurrence records400

Data sources7

Biological traits0

DNA specimens18

eDNA detections16

Sources7 archives

Databases and archives Eutricopis nexilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility400 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF400 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD18 specimens

01Narrative

Eutricopis nexilis, the white-spotted midget, is a moth of the family Noctuidae. The species was first described by Herbert Knowles Morrison in 1875. It is found in North America from Nova Scotia and New England west across southern Canada to southern Vancouver Island, north to Yukon and south in the mountains to California and Colorado. The wingspan is 18–20 mm. Adults are on wing from May to July. The larvae feed on Antennaria species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutricopis nexilis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

43Tmostly conserved

50Cmostly conserved

73Gvariable

118Tmostly conserved

142Tvariable

187Tmostly conserved

190Tmostly conserved

212Cmostly conserved

235Cmostly conserved

278Tmostly conserved

391Cmostly conserved

400Cmostly conserved

401Tmostly conserved

427Cmostly conserved

428Cmostly conserved

466Avariable

478Cmostly conserved

568Tmostly conserved

646Cvariable

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCACTAAGATTATTAATTCGAGCTGAGTTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Narinosus searsisame family4.4%Microhelia angelicasame family5.3%Schinia nubilasame family5.3%Heliothodes baldwinisame family5.8%Bryophila tephrocharissame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type400 records

Wild obs. + sensor162

Museum / vouchered238

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 69≤1 km 30≤10 km 21>10 km 9

129 georeferenced · 33 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 15≤1 km 79≤10 km 26>10 km 6

126 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	100
University of Alberta Museums (UAM)location not on record	54
East Lansing, US	17
Royal Saskatchewan Museumlocation not on record	11
New Haven, US	10
St. Paul, US	9
Vernal, US	8
Oregon State Arthropod Collectionlocation not on record	7
Denver, US	7
Centre for Biodiversity Genomicslocation not on record	2
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Albuquerque, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

14 institutions · 230 of 238 vouchered records shown · 8 without an institution code

09Environmental DNA16 detections

Where the DNA of Eutricopis nexilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.6–17.6

Seasonal swing summer↔winter30.2 °C

Max temp (day)19.7 °C 18.8–24.5

Min temp (night)7.50 °C 6.60–11.0

Precipitation51.1 mm/mo 42.2–80.6

Air humidity51.8 % 47.4–55.1

Moisture balance-83.2 mm/mo -110–-45.4

Vapour deficit708 Pa 682–1,060

Wind speed4.00 m/s 2.80–4.50

Cloud cover39.7 % 30.5–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)