Eutomostethus luteiventris

(Klug, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Eutomostethus

At a glance

Occurrence records1 301

Data sources9

Biological traits0

DNA specimens68

eDNA detections73

Sources9 archives

Databases and archives Eutomostethus luteiventris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 301 records

Environmental DNA3 datasets · 13 countries73 detections

DNA & barcodingBOLD68 specimens

Genome at a glanceGoaT · NCBI≈265 Mbp

01Narrative

Eutomostethus luteiventris is a species of sawflies belonging to the family Tenthredinidae, subfamily Blennocampinae.BioLib

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutomostethus luteiventris has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes1

eDNA detections73

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus65 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

31Tmostly conserved

94Amostly conserved

184Amostly conserved

286Cmostly conserved

361Avariable

373Avariable

550Avariable

628Avariable

TACATTATACTTTATCTTTGGATTTTGATCTGGAATATTAGGATTATCATTCAGAATACTAATTCGAATAGAATTAGGTATACCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes8

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eutomostethus punctatussame genus8.8%Ametastegia apertasame family10.8%Eutomostethus gagathinussame genus10.8%Euura nitidinotasame family12.0%Macrophya arpaklenasame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eutomostethus luteiventris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈265 209 406 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eutomostethus luteiventris0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.9% BUSCO

08Occurrence & distribution

Record type1 301 records

Wild obs. + sensor778

Museum / vouchered523

Range

Area of Occupancy AOO3 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 374≤1 km 133≤10 km 203>10 km 3

713 georeferenced · 65 without coordinates

Open the mapobservation + sensor778

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 81≤1 km 75≤10 km 186>10 km 1

343 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence523

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZMAAlocation not on record	87
Champaign, US	71
BioFokuslocation not on record	66
NHMOlocation not on record	45
Zürich, CH	32
Oulu, FI	27
OSUClocation not on record	23
ZSMlocation not on record	19
DFlocation not on record	11
neflocation not on record	10
DFFW2018location not on record	9
SLU Artdatabankenlocation not on record	9
NCMGlocation not on record	8
Tilburg, NL	8
Philadelphia, US	5
Natural History Museum Rotterdamlocation not on record	4
Institute of Zoology Slovak Academy of Scienceslocation not on record	3
Stockholm, SE	3
Bavarian State Collection of Zoologylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Tromsø, NO	1
Gothenburg, SE	1
NEFlocation not on record	1
South Kensington, GB	1

25 institutions · 448 of 523 vouchered records shown · 75 without an institution code

09Environmental DNA73 detections

Where the DNA of Eutomostethus luteiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found73

Studies independent surveys3

Countries13

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 73 detections have coordinates

Open the map13 countries0

Grassland5. Wetlands (inland)Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 8.90–15.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.4 °C 12.6–20.0

Min temp (night)8.80 °C 4.20–11.2

Precipitation73.2 mm/mo 55.3–113

Air humidity58.6 % 57.1–60.9

Moisture balance-39.4 mm/mo -51.9–1.30

Vapour deficit658 Pa 453–740

Wind speed3.00 m/s 2.10–4.20

Cloud cover43.6 % 33.5–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eutomostethus luteiventris

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 301 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 301 records