Euthyrhynchus floridanus

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Euthyrhynchus

At a glance

Occurrence records4 320

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Euthyrhynchus floridanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 320 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Euthyrhynchus floridanus, the Florida predatory stink bug, is a species of carnivorous shield bug in the family Pentatomidae, the only species in the genus Euthyrhynchus. It is native to the hottest parts of the southeastern United States and is considered beneficial because it feeds on many species of pest insects. They also feed on things such as grasshoppers and other small insects. This species also hunts in a pack, with up to twelve.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthyrhynchus floridanus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.52%

Haplotypes2

BIN1

Most divergent pair0.92%

Where individuals differ — all 8 variable positions, in barcode order

103Cmostly conserved

196Gmostly conserved

199Amostly conserved

244Cmostly conserved

265Gmostly conserved

356Amostly conserved

580Gvariable

616Amostly conserved

TTTATATTTTTTATTTGGTTTATGATCCGGAATAGTAGGATCCGCCATAAGATTAATTATCCGAATTGAACTTGGACAACCGGGAATATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stiretrus anchoragosame family13.9%Eurydema eckerleinisame family13.9%Dalpada neoclavatasame family14.1%Eurydema spectabilissame family14.2%Omyta centrolineatasame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 320 records

Wild obs. + sensor3 599

Museum / vouchered721

Range

Area of Occupancy AOO11 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2 062≤1 km 445≤10 km 224>10 km 385

3 116 georeferenced · 483 without coordinates

Open the mapobservation + sensor3 599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 187≤1 km 15≤10 km 26>10 km 7

235 georeferenced · 486 without coordinates

Open the institutions mapphysical evidence721

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	204
National Biodiversity Institute, Costa Ricalocation not on record	183
Mexico City, MX	172
Mississippi State, US	31
Durango, MX	28
Logan, US	24
Chicago, US	18
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	12
University of Central Floridalocation not on record	10
Provo, US	4
Washington, US	4
College Station, US	2
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	2
Tapachula, MX	1
Lubbock, US	1
University of Guelphlocation not on record	1
CUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
UDlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
US	1
Australian National Insect Collectionlocation not on record	1

22 institutions · 703 of 721 vouchered records shown · 18 without an institution code

09Environmental DNA8 detections

Where the DNA of Euthyrhynchus floridanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.3 °C 21.4–24.5

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.8 °C 24.9–28.7

Min temp (night)20.1 °C 18.4–20.5

Precipitation131 mm/mo 51.4–215

Air humidity66.6 % 63.2–69.5

Moisture balance3.40 mm/mo -118–77.4

Vapour deficit935 Pa 799–1,117

Wind speed5.40 m/s 1.60–7.30

Cloud cover22.7 % 16.2–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euthyrhynchus floridanus

At a glance

Sources7 archives

At a glance

Record type4 320 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 320 records