Euthycera chaerophylli

(Fabricius, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sciomyzidae/Euthycera

At a glance

Occurrence records1 208

Data sources9

Biological traits0

DNA specimens12

eDNA detections74

Sources9 archives

Databases and archives Euthycera chaerophylli's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI74 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 208 records

Environmental DNA4 datasets · 4 countries74 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Euthycera chaerophylli is a species of fly in the family Sciomyzidae, the marsh flies or snail-killing flies.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthycera chaerophylli has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections74

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

21Gmostly conserved

42Amostly conserved

228Amostly conserved

342Cmostly conserved

ACTCTTTATTTCATTTTTGGGGCTTGAGCAGGTATAGTAGGAACTTCCCTGAGAATTTTAATTCGAGCTGAACTTGGCCACCCTGGTGCA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Euthycera chaerophylli carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J., L. Knutson, K. Jan and C. Berg (1969). "Cytotaxonomic studies of Sciomyzidae (Diptera: Acalyptratae)." Transactions of the American Microscopical Society 88: 331-356. ↗

08Occurrence & distribution

Record type1 208 records

Wild obs. + sensor741

Museum / vouchered467

Range

Area of Occupancy AOO2 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 384≤1 km 136≤10 km 108>10 km 15

643 georeferenced · 98 without coordinates

Open the mapobservation + sensor741

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 179≤1 km 169≤10 km 52>10 km 2

402 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence467

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	114
Helsinki, FI	72
NHMOlocation not on record	62
SLU Artdatabankenlocation not on record	25
Gothenburg, SE	22
Stockholm, SE	17
University of Tokyo, Department of Zoologylocation not on record	15
ZMAAlocation not on record	10
Metsähallituslocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
BioFokuslocation not on record	1
Tromsø, NO	1
Tilburg, NL	1
neflocation not on record	1

14 institutions · 344 of 467 vouchered records shown · 123 without an institution code

09Environmental DNA74 detections

Where the DNA of Euthycera chaerophylli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found74

Studies independent surveys4

Countries4

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 74 detections have coordinates

Open the map4 countries0

Mixed forest on sandy soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 7.10–17.1

Seasonal swing summer↔winter19.3 °C

Max temp (day)19.1 °C 11.7–21.2

Min temp (night)11.5 °C 2.00–13.4

Precipitation84.6 mm/mo 71.1–209

Air humidity61.3 % 58.0–64.1

Moisture balance-10.5 mm/mo -40.3–136

Vapour deficit699 Pa 361–798

Wind speed2.70 m/s 2.40–6.10

Cloud cover50.8 % 41.3–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 74 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euthycera chaerophylli

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 208 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 208 records