Euthyatira pudens

(Guenée, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Drepanidae/Euthyatira

At a glance

Occurrence records1 462

Data sources9

Biological traits0

DNA specimens31

eDNA detections4

Sources9 archives

Databases and archives Euthyatira pudens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 462 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 462 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI≈487 Mbp

01Narrative

Euthyatira pudens, the dogwood thyatirid moth or peach-blossom moth, is a moth of the family Drepanidae. The species was first described by Achille Guenée in 1852. It is found in North America, where it ranges across southern Canada, south to the Gulf of Mexico. The habitat consists of moist forests and riparian zones along creeks at low to middle elevations. The wingspan is 40–45 mm. There are two distinct forms. The common form has pink-white patches at the base, along the costa and at the apex. There is a coppery-brown spot at the anal angle. The hindwings are brown. Form pennsylvanica is darker, blackish near the wing base, and does not have the pink-white patches. Adults are on wing in spring in one generation per year. The larvae feed on Cornus species. The larvae are dark gray black with a white ventral area."Euthyatira pudens (Guenée)". Pacific Northwest Moths. Retrieved August 31, 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthyatira pudens has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

130Gvariable

172Tvariable

232Cmostly conserved

379Avariable

493Amostly conserved

496Amostly conserved

542Cmostly conserved

AACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTTAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes10

BINs2

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euthyatira semicircularissame genus3.6%Euparyphasma maximasame family5.9%Tetheella fluctuosasame family6.2%Emarginea gammophorasame order6.5%Ceranemota improvisasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Euthyatira pudens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈486 594 188 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euthyatira pudens0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 462 records

Wild obs. + sensor1 085

Museum / vouchered377

Range

Area of Occupancy AOO2 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 623≤1 km 141≤10 km 66>10 km 50

880 georeferenced · 205 without coordinates

Open the mapobservation + sensor1 085

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 28≤1 km 45≤10 km 115>10 km 8

196 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	89
University of Alberta Museums (UAM)location not on record	68
Mississippi State, US	50
Vancouver, CA	21
Washington, US	21
Toronto, CA	13
East Lansing, US	12
Royal Saskatchewan Museumlocation not on record	9
Cambridge, US	8
Georgia Museum of Natural Historylocation not on record	8
Vernal, US	6
UDlocation not on record	6
UNHClocation not on record	6
OSUClocation not on record	6
Colorado State Universitylocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Natural History Museum of Utahlocation not on record	4
Edmonton, CA	4
SOVTlocation not on record	2
WWUlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
San Francisco, US	2
Decorah, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Chicago, US	1
Universidad Católica de Manizaleslocation not on record	1
CUlocation not on record	1
Blacksburg, US	1
St. Paul, US	1
Cornell University Insect Collectionlocation not on record	1
Philadelphia, US	1

32 institutions · 362 of 377 vouchered records shown · 15 without an institution code

09Environmental DNA4 detections

Where the DNA of Euthyatira pudens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C -2.90–13.6

Seasonal swing summer↔winter23.6 °C

Max temp (day)18.2 °C 1.50–19.1

Min temp (night)5.20 °C -7.50–8.00

Precipitation68.0 mm/mo 49.9–77.4

Air humidity57.2 % 54.8–62.8

Moisture balance-52.0 mm/mo -79.7–35.4

Vapour deficit626 Pa 238–681

Wind speed3.40 m/s 3.10–3.80

Cloud cover46.0 % 41.9–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euthyatira pudens

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 462 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 462 records