Euthrix laeta

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lasiocampidae/Euthrix

At a glance

Occurrence records126

Data sources7

Biological traits0

DNA specimens19

eDNA detections16

Sources7 archives

Databases and archives Euthrix laeta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF126 records

Environmental DNA1 datasets · 8 countries16 detections

DNA & barcodingBOLD19 specimens

01Narrative

Euthrix laeta is a moth of the family Lasiocampidae first described by Francis Walker in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthrix laeta has left across the world's sequence archives.

At a glance

DNA specimens19

BINs6

Marker genes1

eDNA detections16

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

31Tmostly conserved

34Avariable

38Gmostly conserved

40Avariable

58Amostly conserved

59Tmostly conserved

70Avariable

82Tvariable

100Amostly conserved

112Tmostly conserved

115Tmostly conserved

133Tmostly conserved

139Tmostly conserved

154Cvariable

181Gvariable

187Tmostly conserved

200Gmostly conserved

205Tmostly conserved

214Amostly conserved

220Cvariable

232Tmostly conserved

235Cvariable

238Cmostly conserved

271Cmostly conserved

277Tmostly conserved

282Cmostly conserved

295Tvariable

307Amostly conserved

319Tvariable

328Amostly conserved

331Amostly conserved

334Tvariable

337Tvariable

340Cvariable

343Cmostly conserved

346Tvariable

347Tvariable

349Avariable

358Tmostly conserved

361Tmostly conserved

364Avariable

368Gmostly conserved

370Avariable

373Avariable

376Cvariable

382Amostly conserved

397Tmostly conserved

400Cvariable

403Amostly conserved

412Avariable

418Cvariable

424Amostly conserved

433Amostly conserved

451Cmostly conserved

460Tmostly conserved

490Tmostly conserved

499Tmostly conserved

508Gvariable

517Amostly conserved

520Tmostly conserved

523Tmostly conserved

532Tmostly conserved

538Tmostly conserved

544Tmostly conserved

547Tmostly conserved

553Tmostly conserved

565Amostly conserved

586Cvariable

595Cvariable

607Tvariable

616Tmostly conserved

628Amostly conserved

631Avariable

634Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGTGCAGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes12

BINs6

Most divergent pair7.3%

OtherAsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euthrix improvisasame genus6.2%Euthrix isocymasame genus6.4%Euthrix vulpessame genus7.1%Eteinopla signatasame family7.4%Radhica flavovittatasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031507 ↗ · 13 protein · 22 tRNA · 2 rRNA

NADH dehydrogenase subunit 2cytochrome c oxidase subunit Icytochrome c oxidase subunit IIATP synthase F0 subunit 8ATP synthase F0 subunit 6cytochrome c oxidase subunit IIINADH dehydrogenase subunit 3NADH dehydrogenase subunit 5NADH dehydrogenase subunit 4NADH dehydrogenase subunit 4LNADH dehydrogenase subunit 6cytochrome bNADH dehydrogenase subunit 116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type126 records

Wild obs. + sensor77

Museum / vouchered49

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 27≤1 km 24≤10 km 6>10 km 4

61 georeferenced · 16 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3>10 km 1

4 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museum of Natural Sciencelocation not on record	13
FACTlocation not on record	10
Taiwan Forestry Research Institutelocation not on record	10
Helsinki, FI	6
Tartu, EE	3
Philadelphia, US	2
NSMKlocation not on record	2
Naturalis Biodiversity Centerlocation not on record	1
Zürich, CH	1

9 institutions · 48 of 49 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Euthrix laeta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.2–25.8

Seasonal swing summer↔winter1.70 °C

Max temp (day)24.0 °C 21.5–29.3

Min temp (night)17.0 °C 14.1–24.4

Precipitation153 mm/mo 74.4–285

Air humidity68.5 % 64.2–71.9

Moisture balance35.3 mm/mo -4.90–177

Vapour deficit759 Pa 718–985

Wind speed1.70 m/s 0.8–2.70

Cloud cover48.4 % 23.7–69.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)