Euthochtha galeator

(Fabricius, 1803) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Euthochtha

At a glance

Occurrence records4 737

Data sources9

Biological traits0

DNA specimens14

eDNA detections14

Sources9 archives

Databases and archives Euthochtha galeator's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 737 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 737 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT2n = 22

01Narrative

Euthochtha is a genus of leaf-footed bugs in the family Coreidae (Coreid bugs), containing only one described species, E. galeator. It is sometimes referred to by the common name "helmeted squash bug". E. galeator late instar nymph

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthochtha galeator has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes2

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

13Tmostly conserved

28Amostly conserved

31Gmostly conserved

34Tmostly conserved

37Gmostly conserved

76Gmostly conserved

79Cmostly conserved

121Tmostly conserved

169Tmostly conserved

184Gmostly conserved

211Gmostly conserved

271Tmostly conserved

284Tmostly conserved

322Amostly conserved

346Gmostly conserved

358Cmostly conserved

376Amostly conserved

394Tmostly conserved

424Amostly conserved

514Tmostly conserved

526Amostly conserved

542Cmostly conserved

565Gmostly conserved

586Tmostly conserved

625Amostly conserved

634Tmostly conserved

640Tmostly conserved

AACATTATATTTTATTTTCGGTATATGATCGGGTATGGTAGGTTCATCTATAAGATGAATTATTCGTGTTGAACTGGGCCAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes4

BINs2

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dicranocephalus mediussame order14.0%Chorosoma schillingiisame order14.4%Chorosoma macilentumsame order14.4%Leptocoris mitellatussame order14.6%Notonecta triguttatasame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Euthochtha galeator carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 211×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 221×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type4 737 records

Wild obs. + sensor4 538

Museum / vouchered199

Range

Area of Occupancy AOO12 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 228≤1 km 827≤10 km 197>10 km 411

3 663 georeferenced · 875 without coordinates

Open the mapobservation + sensor4 538

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 34≤10 km 91>10 km 3

129 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	121
Mississippi State, US	27
University of Central Floridalocation not on record	16
Denver, US	6
University of Guelphlocation not on record	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	5
Montgomery, US	4
Natural History Museum of Utahlocation not on record	2
College Station, US	2
Chicago, US	2
Vancouver, CA	1
OSUClocation not on record	1
CUlocation not on record	1
Lubbock, US	1
University Park, US	1
North Carolina State University Insect Museumlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

17 institutions · 197 of 199 vouchered records shown · 2 without an institution code

09Environmental DNA14 detections

Where the DNA of Euthochtha galeator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 21.2–27.6

Seasonal swing summer↔winter22.6 °C

Max temp (day)27.2 °C 26.8–33.2

Min temp (night)18.2 °C 16.6–23.1

Precipitation134 mm/mo 89.7–137

Air humidity57.9 % 57.8–59.4

Moisture balance-53.5 mm/mo -86.8–-16.9

Vapour deficit1,122 Pa 1,022–1,510

Wind speed4.80 m/s 2.20–5.80

Cloud cover37.2 % 29.3–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euthochtha galeator

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 737 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 737 records