Euthamia leptocephala

(Torr. & A.Gray) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Euthamia

At a glance

Occurrence records739

Data sources11

Biological traits9

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Euthamia leptocephala's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility739 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF739 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Euthamia leptocephala, the bushy goldentop or Mississippi Valley goldentop, is a North American species of plants in the family Asteraceae. It is native to the south-central United States, in the lower Mississippi Valley and the Coastal Plain of the Gulf of Mexico, from Texas to west-central Georgia and north as far as southern Illinois.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthamia leptocephala has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF477650.1 ↗628 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTACAACAACCATGCCAGGCCGGGTCGGGCGCTCGTTCGTCTGTTCCTATTGGCA …

Euthamia leptocephala internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Euthamia leptocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–542n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Sherif, A. S., E. B. Smith & K. L. Hornberger. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 508.

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

CCDB · eflora

2n 541×CCDB · Cave1963

CCDB · Cave1963 — Beaudry 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type739 records

Wild obs. + sensor325

Museum / vouchered414

Range

Area of Occupancy AOO2 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 206≤1 km 18≤10 km 6>10 km 22

252 georeferenced · 73 without coordinates

Open the mapobservation + sensor325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 23≤1 km 53≤10 km 112>10 km 7

195 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence414

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	55
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	54
Bronx, US	48
Chapel Hill, US	44
Jena Microbial Resource Collectionlocation not on record	33
Austin, US	30
Fort Worth, US	29
Jackson, US	24
Fayetteville, US	14
Little Rock, US	11
Bloomington, US	7
BAYLUlocation not on record	6
Flagstaff, US	5
Tuscaloosa, US	5
Denton, US	4
Wuzhou, CN	4
Bangkok, TH	3
Conway, US	3
Mississippi State, US	3
Williamsburg, US	3
China Agricultural Universitylocation not on record	3
Riverside, US	2
San Angelo, US	2
EL PASO, US	2
Edmonton, CA	2
Phoenix, US	2
Columbia, US	1
AUAlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Clemson, US	1
Tulane Universitylocation not on record	1
Russellville, US	1
Denver, US	1
Pittsburg, US	1
Lubbock, US	1
Ann Arbor, US	1
Chadron, US	1
Québec, CA	1
Baltimore, US	1
GAlocation not on record	1

40 institutions · 412 of 414 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Euthamia leptocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)