Euthalia adonia

Cramer, 1782 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Euthalia

At a glance

Occurrence records199

Data sources6

Biological traits0

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Euthalia adonia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

DNA & barcodingBOLD6 specimens

01Narrative

Euthalia adonia is a butterfly of the family Nymphalidae (Limenitidinae). It is found in the Indomalayan realm." Euthalia " Hübner, [1819" at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euthalia adonia has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCTCTTAGTTTATTAATTCGTACTGAACTTGGAAACCCAGGATCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euthalia malaccanasame genus4.4%Euthalia ivasame genus5.9%Euphaedra hybridasame family6.1%Euphaedra margaritiferasame family6.1%Euphaedra eleussame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor170

Museum / vouchered29

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 66≤1 km 54≤10 km 16>10 km 12

148 georeferenced · 22 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 19

26 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Museum Zoologicum Bogoriense, Bogorlocation not on record	1
Auckland, NZ	1

3 institutions · 4 of 29 vouchered records shown · 25 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)