Eutelia geyeri

Felder & Rogenhofer, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Euteliidae/Eutelia

At a glance

Occurrence records260

Data sources7

Biological traits0

DNA specimens8

eDNA detections7

Sources7 archives

Databases and archives Eutelia geyeri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF260 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Eutelia geyeri is a moth of the family Noctuidae first described by Rudolf Felder and Alois Friedrich Rogenhofer in 1874. This species is found in India, Sri Lanka, China and Japan, as well as from Africa, where its presence had been reported from Lesotho and Seychelles.Fletcher, T. B. 1910a. The Percy Sladen Trust Expedition to the Indian Ocean in 1905. Transactions of the Linnean Society of London (2)Zool. 13(1): p.273

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutelia geyeri has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.27%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

118Cvariable

433Amostly conserved

556Amostly conserved

616Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eutelia adulatricoidessame genus5.3%Eutelia adulatrixsame genus5.5%Eutelia amatrixsame genus6.1%Eutelia catephioidessame genus6.4%Eutelia gaedeisame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type260 records

Wild obs. + sensor49

Museum / vouchered211

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 12≤1 km 10≤10 km 1>10 km 5

28 georeferenced · 21 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 17≤1 km 5>10 km 3

25 georeferenced · 186 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gifu prefectural Museumlocation not on record	51
Iwate Prefectural Museumlocation not on record	22
Helsinki, FI	20
JP	18
Hiwa Museum of Natural Historylocation not on record	16
Tomioka, JP	12
RCMlocation not on record	11
Taiwan Forestry Research Institutelocation not on record	11
FACTlocation not on record	8
Kawasaki Shi Tama Ku, JP	8
Chiba, JP	5
KOMlocation not on record	5
KIRMlocation not on record	5
tesrilocation not on record	4
Toyota city nature sanctuarylocation not on record	3
Ishikawa Museum of Natural Historylocation not on record	2
Sagamihara, JP	2
Itami Shi, JP	2
Naturalis Biodiversity Centerlocation not on record	1
HUNMlocation not on record	1
MZLUlocation not on record	1

21 institutions · 208 of 211 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Eutelia geyeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 17.6–25.8

Seasonal swing summer↔winter14.2 °C

Max temp (day)24.6 °C 20.7–27.6

Min temp (night)19.3 °C 13.2–23.3

Precipitation339 mm/mo 199–495

Air humidity68.0 % 61.8–73.6

Moisture balance223 mm/mo 75.1–354

Vapour deficit896 Pa 660–1,077

Wind speed1.90 m/s 1.60–2.80

Cloud cover47.5 % 38.2–67.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)