Eustrophus tomentosus

Say, 1826 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Tetratomidae/Eustrophus

At a glance

Occurrence records301

Data sources7

Biological traits0

DNA specimens23

eDNA detections18

Sources7 archives

Databases and archives Eustrophus tomentosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF301 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD23 specimens

01Narrative

Eustrophus tomentosus is a species of polypore fungus beetle in the family Tetratomidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eustrophus tomentosus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

103Tmostly conserved

202Cmostly conserved

250Tmostly conserved

304Amostly conserved

337Amostly conserved

493Amostly conserved

536Tmostly conserved

538Amostly conserved

619Amostly conserved

628Gmostly conserved

634Tvariable

CACTCTTTACTTCATTTTTGGTATTTGATCAGGAATAGTAGGAACCTCTTTAAGAATACTAATTCGATCTGAATTAGGAAACCCAGGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BIN1

Most divergent pair0.47%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tachinus marginellussame order13.4%Canthon juvencussame order13.7%Lasconotus borealissame order13.8%Lasconotus intricatussame order13.8%Conotelus obscurussame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type301 records

Wild obs. + sensor43

Museum / vouchered258

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 25≤1 km 6≤10 km 1

32 georeferenced · 11 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 42≤10 km 2>10 km 1

45 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	124
MAJClocation not on record	42
OSUClocation not on record	19
University of Guelphlocation not on record	17
Wuzhou, CN	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
East Lansing, US	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Albuquerque, US	3
Biodiversity Institute of Ontariolocation not on record	2
Lexington, US	2
CUlocation not on record	1
Vancouver, CA	1
Cambridge, US	1
Chicago, US	1
University of Central Floridalocation not on record	1

16 institutions · 245 of 258 vouchered records shown · 13 without an institution code

09Environmental DNA18 detections

Where the DNA of Eustrophus tomentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForest1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 12.0–21.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.1 °C 17.0–25.1

Min temp (night)13.3 °C 6.20–17.8

Precipitation91.0 mm/mo 79.9–106

Air humidity57.5 % 54.0–59.6

Moisture balance-39.2 mm/mo -68.3–-13.4

Vapour deficit747 Pa 607–1,051

Wind speed2.80 m/s 2.10–4.00

Cloud cover40.6 % 37.9–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)