Eustixia pupula

Hübner, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Eustixia

At a glance

Occurrence records2 343

Data sources7

Biological traits0

DNA specimens36

eDNA detections21

Sources7 archives

Databases and archives Eustixia pupula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 343 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD36 specimens

01Narrative

Eustixia is a monotypic moth genus of the family Crambidae described by Jacob Hübner in 1823. Its only species, Eustixia pupula, the spotted peppergrass moth, described by the same author in the same publication, is found in North America from Massachusetts to Florida, west to Texas and north to Ontario. The wingspan is about 17 mm. Adults are on wing from June to August. The larvae feed on the leaves of Lepidium species, Thlaspi arvense and cabbage.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eustixia pupula has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes15

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

1Gmostly conserved

268Amostly conserved

403Amostly conserved

529Avariable

GACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes8

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Crocidolomia luteolalissame family6.4%Prorasea pulveralissame family6.7%Prorasea fernaldisame family6.8%Prorasea simalissame family6.8%Prorasea sideralissame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type2 343 records

Wild obs. + sensor2 175

Museum / vouchered168

Range

Area of Occupancy AOO4 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 223≤1 km 264≤10 km 65>10 km 273

1 825 georeferenced · 350 without coordinates

Open the mapobservation + sensor2 175

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 3≤1 km 28≤10 km 65>10 km 21

117 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	33
Mississippi State, US	26
East Lansing, US	21
Philadelphia, US	18
King Saud Universitylocation not on record	15
Cambridge, US	11
Georgia Museum of Natural Historylocation not on record	9
CUlocation not on record	7
Washington, US	5
St. Paul, US	4
Denver, US	3
Universidad de Sucre (UniSucre)location not on record	3
Cornell University Insect Collectionlocation not on record	3
North Carolina State University Insect Museumlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Natural History Museum of Utahlocation not on record	1
OSUClocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Natural History Museum Rotterdamlocation not on record	1
Champaign, US	1

20 institutions · 168 of 168 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Eustixia pupula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 22.6–25.0

Seasonal swing summer↔winter20.2 °C

Max temp (day)29.4 °C 27.7–30.5

Min temp (night)18.2 °C 17.8–22.6

Precipitation82.2 mm/mo 56.1–125

Air humidity55.3 % 53.4–60.7

Moisture balance-95.3 mm/mo -128–-27.7

Vapour deficit1,302 Pa 1,169–1,368

Wind speed4.30 m/s 3.50–4.40

Cloud cover29.6 % 28.0–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eustixia pupula

At a glance

Sources7 archives

At a glance

Record type2 343 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 343 records