Euspilapteryx auroguttella

Stephens, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Euspilapteryx

At a glance

Occurrence records4 308

Data sources9

Biological traits2

DNA specimens104

eDNA detections241

Sources9 archives

Databases and archives Euspilapteryx auroguttella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 308 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI241 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics104 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 308 records

Environmental DNA4 datasets · 17 countries241 detections

DNA & barcodingBOLD104 specimens

Genome at a glanceGoaT · NCBI≈332 Mbp

01Narrative

Euspilapteryx auroguttella is a moth of the family Gracillariidae. It is known from all of Europe. A sprig of Hypericum with leaves mined and rolled into cones Larva The wingspan is 9–10 mm.Antennae with apex white. Forewings dark fuscous, purplish- tinged ; a roundish spot below costa at 1/3, another on costa at 2/3, and two on dorsum near base and before tornus bright yellow. Hindwings are grey.The larva is whitish-green ; dorsal line greener ; head pale yellow-brown. Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing in May and August in two generations. The larvae feed on Hypericum adenotrichum, Hypericum elegans, Hypericum hircinum, Hypericum hirsutum, Hypericum humifusum, Hypericum maculatum, Hypericum montanum, Hypericum olympicum, Hypericum perforatum, Hypericum rhodoppeum and Hypericum tetrapterum. They mine the leaves of their host plant. The mine starts as a lower-surface epidermal corridor. The last section is widened into a blotch. Only then the larva begins to consume parenchymatous tissue and to line the inside of the mine with silk. The leaf folds itself around the mine. The frass is deposited in a clump in a corner of the mine. Older larvae leave the mine and live freely in a leaf tip that has been folded downwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding104 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euspilapteryx auroguttella has left across the world's sequence archives.

At a glance

DNA specimens104

BINs1

Marker genes3

eDNA detections241

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

151Cmostly conserved

212Cmostly conserved

274Tmostly conserved

463Tmostly conserved

646Tmostly conserved

AACTCTATATTTTATTTTTGGTATTTGAGCTGGAATATTAGGAACTTCACTAAGTATGTTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes14

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Caloptilia strictellasame family9.6%Caloptilia anthobaphessame family9.6%Caloptilia alnivorellasame family9.6%Caloptilia sapporellasame family10.0%Caloptilia coroniellasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alphaH3

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Euspilapteryx auroguttella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈331 897 825 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euspilapteryx auroguttella0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.3% BUSCO

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type4 308 records

Wild obs. + sensor3 734

Museum / vouchered561

Other13

Origin

Native73

Range

Area of Occupancy AOO9 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 1 557≤1 km 854≤10 km 1 049>10 km 17

3 477 georeferenced · 257 without coordinates

Open the mapobservation + sensor3 734

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 325≤1 km 92≤10 km 53

470 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence561

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	80
DanishLepidopterologicalSocietylocation not on record	60
Kuopio, FI	29
SLU Artdatabankenlocation not on record	27
Tartu, EE	24
Salzburg, AT	16
neflocation not on record	6
South Kensington, GB	6
Tilburg, NL	6
ZMAAlocation not on record	5
BioFokuslocation not on record	4
Provincia di Livornolocation not on record	3
Nijmegen, NL	3
ZSMlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Rovaniemi, FI	2
Uniwersytet Łódzkilocation not on record	2
University of Kaiserslauternlocation not on record	1
Oulu, FI	1
Metsähallituslocation not on record	1
Tallinn, EE	1
NTNU-VMlocation not on record	1
Research Collection of Richard Heindellocation not on record	1
Radicondoli, IT	1

24 institutions · 285 of 561 vouchered records shown · 276 without an institution code

09Environmental DNA241 detections

Where the DNA of Euspilapteryx auroguttella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found241

Studies independent surveys4

Countries17

Verifiable raw sequence linked135

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 241 detections have coordinates

Open the map17 countries0

oak woodlandoakwoodland forestprivate gardenUrbanedge woodland/meadowwet forest/swamp

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 10.4–18.9

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.0 °C 14.4–22.5

Min temp (night)12.5 °C 5.90–15.6

Precipitation69.7 mm/mo 42.9–124

Air humidity60.6 % 57.7–62.9

Moisture balance-38.0 mm/mo -86.1–10.0

Vapour deficit724 Pa 539–871

Wind speed3.10 m/s 2.20–5.30

Cloud cover42.3 % 34.6–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 239 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euspilapteryx auroguttella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type4 308 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 308 records