Eusphecia melanocephala

(Dalman, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sesiidae/Eusphecia

At a glance

Occurrence records702

Data sources7

Biological traits0

DNA specimens14

eDNA detections13

Sources7 archives

Databases and archives Eusphecia melanocephala's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility702 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF702 records

Environmental DNA1 datasets · 7 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Eusphecia melanocephala is a moth of the family Sesiidae. It is found in central, eastern and northern Europe and parts of western Europe as well as Asia. The range extends from the Pyrenees, through southern France and central Europe into Asia. In the north, it can be found up to Fennoscandia and in the south down to the southern edge of the Alps and the northern Balkans. The wingspan is 30–40 mm. Adults are on wing from June to July in one generation depending on the location. The larvae feed on Populus tremula.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eusphecia melanocephala has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections13

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

40Amostly conserved

160Gmostly conserved

202Cvariable

206Tvariable

271Amostly conserved

451Cmostly conserved

562Tmostly conserved

622Tmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGTACCTCTCTCAGTCTCTTAATTCGAGCTGAATTAGGGACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes6

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achlya flavicornissame order10.9%Cephalospargeta elongatasame order11.1%Ochropacha duplarissame order11.4%Prepocosma tropicasame order11.4%Arescoptera haplocalasame order11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type702 records

Wild obs. + sensor646

Museum / vouchered56

Range

Area of Occupancy AOO1 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 221≤1 km 81≤10 km 139>10 km 17

458 georeferenced · 188 without coordinates

Open the mapobservation + sensor646

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 18≤1 km 10≤10 km 20>10 km 2

50 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	32
Research Collection of Franz Puehringerlocation not on record	2
NHMOlocation not on record	2
SLU Artdatabankenlocation not on record	2
ZMAAlocation not on record	2
Tartu, EE	1
Rovaniemi, FI	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

9 institutions · 44 of 56 vouchered records shown · 12 without an institution code

09Environmental DNA13 detections

Where the DNA of Eusphecia melanocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 3.40–18.6

Seasonal swing summer↔winter20.3 °C

Max temp (day)19.2 °C 5.90–22.4

Min temp (night)10.5 °C -0.2–13.1

Precipitation85.6 mm/mo 61.1–126

Air humidity60.0 % 57.7–64.2

Moisture balance-23.5 mm/mo -51.1–53.9

Vapour deficit718 Pa 342–867

Wind speed3.40 m/s 2.00–4.10

Cloud cover38.0 % 33.4–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)