Eusphalerum minutum

(Fabricius, 1792) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Eusphalerum

At a glance

Occurrence records1 864

Data sources7

Biological traits2

DNA specimens24

eDNA detections63

Sources7 archives

Databases and archives Eusphalerum minutum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 864 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 864 records

Environmental DNA4 datasets · 4 countries63 detections

DNA & barcodingBOLD24 specimens

01Narrative

Eusphalerum minutum is a species of rove beetles native to Europe.Fauna EuropaeaNorman H. Joy, , 1932 A Practical Handbook of British Beetles

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eusphalerum minutum has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections63

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

100Amostly conserved

142Tmostly conserved

316Amostly conserved

343Cmostly conserved

355Cmostly conserved

493Amostly conserved

496Amostly conserved

AACCCTATATTTTATTTTTGGTGCCTGAGCAGGAATAGTCGGAACTTCATTAAGAATATTAATTCGGGCAGAATTAGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes4

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eusphalerum torquatumsame genus8.7%Eusphalerum pallenssame genus9.9%Eusphalerum alpinumsame genus9.9%Eusphalerum analesame genus10.0%Eusphalerum longipennesame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 864 records

Wild obs. + sensor697

Museum / vouchered1 086

Cultivated / captive2

Fossil79

Range

Area of Occupancy AOO4 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 295≤1 km 223≤10 km 131>10 km 1

650 georeferenced · 47 without coordinates

Open the mapobservation + sensor697

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 257≤1 km 244≤10 km 275>10 km 54

830 georeferenced · 256 without coordinates

Open the institutions mapphysical evidence1 086

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	219
Gothenburg, SE	130
Helsinki, FI	99
Olocation not on record	66
Tartu, EE	52
NHMOlocation not on record	49
Trondheim, NO	35
Akademia Pomorska w Słupskulocation not on record	27
Kuopio, FI	25
NTNU-VMlocation not on record	25
Tromsø, NO	23
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	21
Salzburg, AT	20
neflocation not on record	19
Metsähallituslocation not on record	17
NMBU:MINAlocation not on record	14
ZMAAlocation not on record	12
Muzeum Górnośląskie w Bytomiulocation not on record	11
LSMlocation not on record	10
TMPMlocation not on record	9
Tilburg, NL	9
Tallinn, EE	8
CBDClocation not on record	8
Philadelphia, US	7
South Kensington, GB	7
Copenhagen, DK	6
BioFokuslocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	5
Uniwersytet Wrocławskilocation not on record	4
Rovaniemi, FI	3
NMOKlocation not on record	3
MZLUlocation not on record	3
IFR-DNFlocation not on record	2
Ugentlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Jyväskylä, FI	1

38 institutions · 963 of 1 086 vouchered records shown · 123 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA63 detections

Where the DNA of Eusphalerum minutum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys4

Countries4

Verifiable raw sequence linked36

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map4 countries0

QuellmoorBog edge in alpine birch forestBachtal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 10.4–14.4

Seasonal swing summer↔winter20.5 °C

Max temp (day)15.7 °C 14.2–18.1

Min temp (night)8.20 °C 5.80–10.1

Precipitation138 mm/mo 67.5–138

Air humidity62.1 % 57.9–62.1

Moisture balance43.3 mm/mo -39.0–43.3

Vapour deficit563 Pa 501–655

Wind speed2.40 m/s 2.40–4.20

Cloud cover52.5 % 33.3–55.7

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eusphalerum minutum

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 864 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 864 records