Eusiphona mira

Coquillett, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Milichiidae/Eusiphona

At a glance

Occurrence records28

Data sources7

Biological traits0

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Eusiphona mira's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Eusiphona mira is a species of freeloader flies in the family Milichiidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eusiphona mira has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes1

BIN1

Where individuals differ — all 15 variable positions, in barcode order

87Cvariable

88Tvariable

129Cvariable

189Cvariable

280Tvariable

283Tvariable

294Tvariable

342Tvariable

414Cvariable

429Avariable

495Avariable

540Tvariable

558Cvariable

570Cvariable

618Avariable

TTATATTTTATTTTCGGTGCTTGAGCTGGAATAGTAGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGACATCCAGGAGCCTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Olcella parvasame order7.3%Eugaurax floridensissame order7.7%Biorbitella hesperiasame order7.8%Tricimba cinctasame order8.0%Aphanotrigonum darlingtoniaesame order8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor8

Museum / vouchered20

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 2

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lake Placid, US	15
McGill University, Lyman Entomological Museumlocation not on record	4
Albuquerque, US	1

3 institutions · 20 of 20 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Eusiphona mira was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Bog8. Desert | 8.1. Hot DesertMeadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 14.4–22.4

Seasonal swing summer↔winter27.6 °C

Max temp (day)22.8 °C 18.5–29.4

Min temp (night)13.7 °C 10.8–17.3

Precipitation107 mm/mo 20.2–143

Air humidity57.5 % 48.7–59.5

Moisture balance-33.9 mm/mo -146–13.3

Vapour deficit913 Pa 691–1,325

Wind speed2.20 m/s 2.10–3.50

Cloud cover44.7 % 24.7–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)