Euscirrhopterus poeyi

Grote, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euscirrhopterus

At a glance

Occurrence records431

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Euscirrhopterus poeyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF431 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Euscirrhopterus poeyi, the pullback moth, is a moth of the family Noctuidae. The species was first described by Augustus Radcliffe Grote in 1866. It is found from southern Florida and Mexico, through Central America to Brazil. It is also found in the Caribbean, including Cuba. The wingspan is about 34 mm for females and 38 mm for males. Adults are sexually dimorphic. Males are smaller and their wings are characterized by large areas of hyaline (glass-like) membrane lacking scales. Females are larger without the hyaline membranous areas. The general color is a dark gray brown.Noctuidae of North America The larvae feed on Pisonia aculeata.Search Results Euscirrhopterus poeyi. HOSTS - a Database of the World's Lepidopteran Hostplants. Natural History Museum, London. Retrieved December 2, 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euscirrhopterus poeyi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

1Tmostly conserved

5Cmostly conserved

37Gmostly conserved

52Tmostly conserved

56Cmostly conserved

59Cmostly conserved

73Amostly conserved

74Cmostly conserved

82Cmostly conserved

92Tmostly conserved

160Amostly conserved

172Cmostly conserved

206Tmostly conserved

220Cmostly conserved

238Cmostly conserved

266Cmostly conserved

271Cmostly conserved

292Tmostly conserved

298Cmostly conserved

337Cmostly conserved

346Cmostly conserved

370Amostly conserved

397Tmostly conserved

400Tmostly conserved

418Tmostly conserved

484Cmostly conserved

490Cmostly conserved

520Gmostly conserved

539Cmostly conserved

547Cmostly conserved

548Cmostly conserved

571Cmostly conserved

610Tmostly conserved

616Cvariable

628Amostly conserved

634Tmostly conserved

TACACTATATTTTATTTTTGGTATTTGATCAGGAATGGTAGGAACTTCTCTTAGACTACTAATTCGAGCAGAACTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes5

BINs2

Most divergent pair5.2%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euscirrhopterus argentatasame genus4.9%Alypiodes geronimosame family6.1%Agaristodes feisthameliisame family6.5%Aucula particolorsame family6.7%Phalaenoides glycinaesame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type431 records

Wild obs. + sensor68

Museum / vouchered363

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 26≤1 km 19≤10 km 2>10 km 1

48 georeferenced · 20 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 361 without coordinates

Open the institutions mapphysical evidence363

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	204
Tapachula, MX	152
ZSMlocation not on record	3
Ciudad de México, MX	2
Area de Conservacion Guanacastelocation not on record	1
San Francisco, US	1

6 institutions · 363 of 363 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Euscirrhopterus poeyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 25.2–27.3

Seasonal swing summer↔winter4.20 °C

Max temp (day)29.2 °C 28.5–31.1

Min temp (night)23.4 °C 21.8–25.4

Precipitation164 mm/mo 64.6–269

Air humidity63.9 % 61.2–66.1

Moisture balance-16.7 mm/mo -132–101

Vapour deficit1,311 Pa 1,089–1,370

Wind speed3.00 m/s 1.30–4.20

Cloud cover28.3 % 20.9–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)