Euscirrhopterus gloveri

Grote & Robinson, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euscirrhopterus

At a glance

Occurrence records1 507

Data sources6

Biological traits0

DNA specimens5

eDNA detections6

Sources6 archives

Databases and archives Euscirrhopterus gloveri's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 507 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 507 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Euscirrhopterus gloveri, the purslane moth, is an owlet moth (family Noctuidae). The species was first described by Augustus Radcliffe Grote and Coleman Townsend Robinson in 1868. It is found in North America. The MONA or Hodges number for Euscirrhopterus gloveri is 9307.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euscirrhopterus gloveri has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

229Amostly conserved

436Amostly conserved

536Tmostly conserved

625Amostly conserved

AACATTATATTTTATTTTCGGTATTTGATCAGGAATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agaristodes feisthameliisame family5.5%Comocrus behrisame family5.5%Alypiodes geronimosame family5.5%Phalaenoides glycinaesame family5.6%Euscirrhopterus klagesisame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 507 records

Wild obs. + sensor1 045

Museum / vouchered462

Range

Area of Occupancy AOO2 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 534≤1 km 103≤10 km 69>10 km 156

862 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 045

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 39≤1 km 30≤10 km 247>10 km 38

354 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence462

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	161
Colorado State Universitylocation not on record	85
East Lansing, US	51
Mississippi State, US	43
Awka, NG	27
New Haven, US	13
US	13
Albuquerque, US	11
Denver, US	11
King Saud Universitylocation not on record	9
St. Paul, US	7
University of California, Davislocation not on record	7
München, DE	6
University of Alberta Museums (UAM)location not on record	4
San Diego, US	3
Philadelphia, US	3
Universidad Católica de Manizaleslocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Natural History Museum of Utahlocation not on record	1

19 institutions · 459 of 462 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Euscirrhopterus gloveri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 9.40–25.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)30.7 °C 15.5–31.5

Min temp (night)18.5 °C 3.90–18.9

Precipitation107 mm/mo 59.5–111

Air humidity50.1 % 47.4–53.0

Moisture balance-67.1 mm/mo -79.0–-23.5

Vapour deficit1,474 Pa 697–1,601

Wind speed2.00 m/s 1.90–2.70

Cloud cover17.8 % 16.8–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euscirrhopterus gloveri

At a glance

Sources6 archives

At a glance

Record type1 507 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 507 records