Euscirrhopterus cosyra

Druce, 1896 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euscirrhopterus

At a glance

Occurrence records963

Data sources4

Biological traits0

DNA specimens5

eDNA detections0

Sources4 archives

Databases and archives Euscirrhopterus cosyra's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility963 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF963 records

DNA & barcodingBOLD5 specimens

01Narrative

Euscirrhopterus cosyra, the staghorn cholla moth, is a moth in the family Noctuidae (the owlet moths). The species was first described by Herbert Druce in 1896. The MONA or Hodges number for Euscirrhopterus cosyra is 9308.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euscirrhopterus cosyra has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

212Tvariable

412Avariable

TACATTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alypiodes geronimosame family5.3%Phalaenoides glycinaesame family5.5%Neotuerta sabulosasame family5.8%Agaristodes feisthameliisame family6.1%Comocrus behrisame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type963 records

Wild obs. + sensor881

Museum / vouchered82

Range

Area of Occupancy AOO1 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 491≤1 km 77≤10 km 32>10 km 67

667 georeferenced · 214 without coordinates

Open the mapobservation + sensor881

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤1 km 3≤10 km 29>10 km 8

41 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	17
Mississippi State, US	13
ASUlocation not on record	11
US	11
Albuquerque, US	8
Denver, US	7
Colorado State Universitylocation not on record	6
University of California, Davislocation not on record	4
New Haven, US	1
St. Paul, US	1

10 institutions · 79 of 82 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)