Euscelis incisa

(Kirschbaum, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Euscelis

At a glance

Occurrence records4 127

Data sources7

Biological traits0

DNA specimens49

eDNA detections110

Sources7 archives

Databases and archives Euscelis incisa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 127 records

Environmental DNA4 datasets · 5 countries110 detections

DNA & barcodingBOLD49 specimens

01Narrative

Euscelis incisa is a leafhopper species in the family Cicadellidae. It is found in Europe, North Africa, and Asia. It is formerly known as Euscelis plebejus, among other names.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euscelis incisa has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections110

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 48 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Cmostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

20Gmostly conserved

23Gmostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

28Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Gmostly conserved

44Amostly conserved

48Cmostly conserved

50Cmostly conserved

54Gmostly conserved

55Amostly conserved

58Amostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

190Amostly conserved

223Amostly conserved

313Amostly conserved

316Amostly conserved

328Gmostly conserved

352Tmostly conserved

445Tmostly conserved

628Gmostly conserved

634Cmostly conserved

AACTCTTTACTTTATTTTTGGGGTTTGGTCAGGAATAATTGGGATAACACTAAGAATAATTATTCGAATTGAATTAGCCCAACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Conosanus obsoletussame family10.3%Euscelis alsiasame genus14.1%Idiodonus joseasame family16.0%Idiodonus cruentatussame family16.4%Osbornellus compressussame family17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 127 records

Wild obs. + sensor3 790

Museum / vouchered281

Cultivated / captive55

Other1

Range

Area of Occupancy AOO7 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 501≤1 km 426≤10 km 744>10 km 20

2 691 georeferenced · 1 099 without coordinates

Open the mapobservation + sensor3 790

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 222≤1 km 38≤10 km 2

262 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence281

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 55 records without

Open the mapnot free-living55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	26
Natural History Museum Rotterdamlocation not on record	19
Natural History Museum, Rangoonlocation not on record	9
Philadelphia, US	2
South Kensington, GB	2
Bavarian State Collection of Zoologylocation not on record	2
Helsinki, FI	1
BioFokuslocation not on record	1
DFlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Tilburg, NL	1

11 institutions · 65 of 281 vouchered records shown · 216 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA110 detections

Where the DNA of Euscelis incisa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys4

Countries5

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map5 countries0

black fallow areaflowering area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.2–17.2

Seasonal swing summer↔winter17.1 °C

Max temp (day)20.2 °C 14.4–21.2

Min temp (night)12.4 °C 10.7–14.9

Precipitation67.4 mm/mo 53.3–84.1

Air humidity60.9 % 58.0–62.6

Moisture balance-56.5 mm/mo -83.9–-18.6

Vapour deficit741 Pa 581–814

Wind speed4.00 m/s 2.90–5.30

Cloud cover41.7 % 37.3–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euscelis incisa

At a glance

Sources7 archives

At a glance

Record type4 127 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 127 records