Eusarca confusaria

Hübner, 1813 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Eusarca

At a glance

Occurrence records10 373

Data sources7

Biological traits0

DNA specimens11

eDNA detections5

Sources7 archives

Databases and archives Eusarca confusaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 373 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 373 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD11 specimens

01Narrative

Eusarca confusaria, the confused eusarca, is a moth species of the family Geometridae that occurs in North America and Brazil. It is the only member of the genus Eusarca that inhabits the northern portion of the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eusarca confusaria has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

4Tmostly conserved

31Tmostly conserved

40Amostly conserved

82Cmostly conserved

85Avariable

88Gmostly conserved

91Amostly conserved

115Tmostly conserved

118Cmostly conserved

121Tmostly conserved

130Cmostly conserved

139Cmostly conserved

163Tmostly conserved

193Cmostly conserved

220Tvariable

253Gmostly conserved

259Tmostly conserved

263Tmostly conserved

271Tvariable

284Tmostly conserved

286Amostly conserved

295Tmostly conserved

319Cmostly conserved

325Cmostly conserved

328Cmostly conserved

340Cmostly conserved

367Cvariable

370Tmostly conserved

379Avariable

382Amostly conserved

385Cmostly conserved

388Gmostly conserved

400Cmostly conserved

418Tmostly conserved

442Tmostly conserved

487Tmostly conserved

490Cmostly conserved

499Tmostly conserved

508Tmostly conserved

517Amostly conserved

539Cmostly conserved

541Amostly conserved

559Amostly conserved

577Amostly conserved

601Cmostly conserved

607Cmostly conserved

634Tvariable

641Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAACCCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes5

BIN1

Most divergent pair6.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eusarca argillariasame genus4.0%Eusarca falcatasame genus4.3%Eusarca subflavariasame genus5.9%Eusarca venosariasame genus6.1%Eusarca fundariasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type10 373 records

Wild obs. + sensor9 587

Museum / vouchered786

Range

Area of Occupancy AOO20 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5 009≤1 km 1 478≤10 km 429>10 km 871

7 787 georeferenced · 1 800 without coordinates

Open the mapobservation + sensor9 587

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 15≤1 km 102≤10 km 336>10 km 47

500 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence786

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	228
East Lansing, US	148
St. Paul, US	58
Cleveland Museum of Natural History, OH (CLEV)location not on record	57
Mississippi State, US	37
Georgia Museum of Natural Historylocation not on record	29
CUlocation not on record	23
Cornell University Insect Collectionlocation not on record	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
Champaign, US	20
Colorado State Universitylocation not on record	19
OSUClocation not on record	13
ASUlocation not on record	13
King Saud Universitylocation not on record	11
Milwaukee Public Museum (MPM)location not on record	11
Philadelphia, US	8
Cambridge, US	7
Centre for Biodiversity Genomicslocation not on record	6
Decorah, US	4
Denver, US	3
Blacksburg, US	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
SOVTlocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
University of Guelphlocation not on record	1
Natural History Museum of Utahlocation not on record	1
University Park, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Washington, US	1

29 institutions · 751 of 786 vouchered records shown · 35 without an institution code

09Environmental DNA5 detections

Where the DNA of Eusarca confusaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.9

Seasonal swing summer↔winter20.0 °C

Max temp (day)23.4 °C 23.4–23.9

Min temp (night)14.9 °C 14.9–15.1

Precipitation178 mm/mo 112–178

Air humidity64.5 % 61.1–64.5

Moisture balance34.5 mm/mo -9.30–34.5

Vapour deficit770 Pa 770–850

Wind speed3.00 m/s 2.20–3.00

Cloud cover27.0 % 27.0–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eusarca confusaria

At a glance

Sources7 archives

At a glance

Record type10 373 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 373 records