Euryops chrysanthemoides

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Euryops

At a glance

Occurrence records1 329

Data sources10

Biological traits31

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Euryops chrysanthemoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 329 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF1 329 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Euryops chrysanthemoides (with the common names African bush daisy or bull's-eye) is a small shrub native to Southern Africa that is also grown as a horticultural specimen in tropical to subtropical regions around the world.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length4 mm

Leaf length80 mm

Leaf length max80 mm

Leaf length min35 mm

Leaf width15 mm

Leaf width max20 mm

Leaf width min10 mm

Plant height1.5 m

Plant height max2 m

Plant height min0.5 m

Seed mass2.18 mg

Seed mass max2.18 mg

Seed mass min2.18 mg

Life cycle & reproduction4

Dehiscenceindehiscent

Flowering timennnynnnnnnnn

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min5 m

Epiphyteterrestrial

Fruit typeachene

Growth formshrub

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Euryops chrysanthemoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Arylnaphthalene and aryltetralin lignans3

Eremophilane sesquiterpenoids2

Documented compounds6 total

Compound	Amount	Source
(4aR,5S)-3,4a,5-trimethyl-5,6-dihydro-4H-benzo[f][1]benzofuran-7,9-dione	present	LOTUS
[(4aR,5S,7R,8aS)-7-hydroxy-3,4a,5-trimethyl-4,5,6,7,8,9-hexahydrobenzo[f][1]benzofuran-8a-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
alpha-Peltatin	present	NPASS
beta-Peltatin	present	NPASS
JZFSMVXQUWRSIW-OSXUVPCZSA-N	present	NPASS
Podophyllotoxin	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euryops chrysanthemoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON951312.1 ↗755 bpKenya · 2014

ACGT

ATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCAGGAGTTCCGCCTGAAGAAGCAG …

Euryops chrysanthemoides voucher PE CPG28847 Z.D. Chen et al. 28847 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Euryops chrysanthemoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — NORDENSTAM, B. 1968. The genus Euryops Part. I. Taxonomy. Opera Bot. No. 20: 1-409.

CCDB · book-fedorov — Ornd uff e t al. 1963

n 101×CCDB · Cave1963

CCDB · Cave1963 — Ornduff et al. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 329 records

Wild obs. + sensor1 183

Museum / vouchered144

Cultivated / captive1

Other1

Origin

Native1

Introduced435

Range

Area of Occupancy AOO3 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 547≤1 km 91≤10 km 359>10 km 22

1 019 georeferenced · 164 without coordinates

Open the mapobservation + sensor1 183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 23≤1 km 14≤10 km 2>10 km 2

41 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence144

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	38
Auckland, NZ	18
Christchurch, NZ	16
Durban, ZA	8
Saint Louis, US	7
Canberra, AU	7
Brisbane, AU	6
Mount Annan, AU	6
Museo Entomologico de Leonlocation not on record	5
Wellington, NZ	3
Batemans Bay, AU	3
Miami, US	2
Kew, GB	2
MeiseBGlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wollongong, AU	1
Hobart, AU	1
Laboratory of Palaeontologylocation not on record	1
Stockholm, SE	1
Riverside, US	1
Antiguo Cuscatlán, SV	1
Adelaide, AU	1
León, NI	1
Guatemala, GT	1
La Paz, BO	1
Smithfield, AU	1
Chongqing Museumlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
València, ES	1
Badajoz, ES	1
Cape Town, ZA	1

32 institutions · 142 of 144 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction4

Diet & foraging1

Habitat & environment12

Other traits1

Compound class profile2 classes

Documented compounds6 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 329 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions25 of 32 geolocated

Cultivated / Captivenot free-living

Record type1 329 records