Euryops arabicus

Steud. ex Jaub. & Spach · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Euryops

At a glance

Occurrence records159

Data sources8

Biological traits8

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Euryops arabicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS18 compounds

Occurrence & distributionGBIF159 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Euryops arabicus is a species of flowering plant in the family Asteraceae that grows in the form of a bush. It is found on the Arabian Peninsula, Socotra, Somalia and Djibouti. Its natural habitat is subtropical or tropical dry shrubland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.15 mg

Seed mass max1.15 mg

Seed mass min1.15 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Euryops arabicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cadinane sesquiterpenoids5

Eremophilane sesquiterpenoids2

Flavonols2

Branched fatty acids2

Eudesmane sesquiterpenoids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(4R)-4-(3,5-dimethyl-1-benzofuran-6-yl)pentanal	present	LOTUS
(4R,4aR,5S)-4-ethoxy-3,4a,5-trimethyl-4,5,6,7-tetrahydrobenzo[f][1]benzofuran-2-one	present	LOTUS
(5S)-3,4,5-trimethyl-5,6-dihydrobenzo[f][1]benzofuran	present	LOTUS
(5S,8R)-8-ethoxy-3,4,5-trimethyl-5,6,7,8-tetrahydrobenzo[f][1]benzofuran	present	LOTUS
(5S,8R)-8-methoxy-3,4,5-trimethyl-5,6,7,8-tetrahydrobenzo[f][1]benzofuran	present	LOTUS
(5S,8S)-8-methoxy-3,4,5-trimethyl-5,6,7,8-tetrahydrobenzo[f][1]benzofuran	present	LOTUS
(E,1R)-1-(3,5-dimethyl-1-benzofuran-6-yl)pent-3-en-1-ol	present	LOTUS
(E,1S)-1-(3,5-dimethyl-1-benzofuran-6-yl)pent-3-en-1-ol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euryops arabicus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEU667465.1 ↗691 bpSomalia

ACGT

CCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAACAATCGGGTGTCCATGGTTTCCGACTATTGT …

Euryops arabicus isolate 9438UPS 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type159 records

Wild obs. + sensor113

Museum / vouchered46

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 52≤1 km 8≤10 km 7>10 km 3

70 georeferenced · 43 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edinburgh, GB	14
Kew, GB	10
Wlocation not on record	7
Uppsala, SE	6
University of Hargeisalocation not on record	3
CASlocation not on record	1
Moscow State Universitylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Austin, US	1

9 institutions · 44 of 46 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Euryops arabicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.9 °C 26.9–27.9

Seasonal swing summer↔winter13.2 °C

Max temp (day)33.3 °C 32.2–33.3

Min temp (night)19.6 °C 19.6–20.8

Precipitation4.50 mm/mo 4.50–18.5

Air humidity40.4 % 40.4–49.5

Moisture balance-167 mm/mo -167–-154

Vapour deficit2,322 Pa 1,813–2,322

Wind speed2.80 m/s 2.80–3.90

Cloud cover9.40 % 9.40–12.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)