Euryopis episinoides

(Walckenaer, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Euryopis

At a glance

Occurrence records814

Data sources6

Biological traits8

DNA specimens111

eDNA detections133

Sources6 archives

Databases and archives Euryopis episinoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility814 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI133 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics111 specimens↗

World Spider Trait DBMasaryk University8 traits · 6 refs↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements6 literature sources8 traits

Occurrence & distributionGBIF814 records

Environmental DNA2 datasets · 11 countries133 detections

DNA & barcodingBOLD111 specimens

01Narrative

Euryopis episinoides est une espèce d'araignées aranéomorphes de la famille des Theridiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár et al. 2018aBuchar & Růžička 2002Řezáč et al. 2015Pekár et al. 2018bLíznarová & Pekár 2019Pekár et al. 2012a

Morphometry1

Cephalothorax length1.12 mm

Predation3

Paralysis latency6.75 mm

Prey OrderCollembola

Prey diversity1 mm

Ecology3

Light 2open

Moisture 2very dry

Regional non-IUCN Red List categoryRegionally Extinct (RE)

Anatomy1

Venom gland size0.015 mm

05DNA & barcoding111 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euryopis episinoides has left across the world's sequence archives.

At a glance

DNA specimens111

BINs1

Marker genes1

eDNA detections133

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus111 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

19Gmostly conserved

55Avariable

193Gmostly conserved

199Gmostly conserved

220Gvariable

250Amostly conserved

253Avariable

259Amostly conserved

298Amostly conserved

316Amostly conserved

430Gmostly conserved

442Tvariable

475Amostly conserved

553Tmostly conserved

613Tmostly conserved

622Amostly conserved

628Gvariable

643Tmostly conserved

ATTATATTTTTTATTTGGGGGATGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGAGTAGAATTAGGTCAACCTGGAAGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes24

BIN1

Most divergent pair2.4%

AfricaAsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euryopis scriptipessame genus8.3%Euryopis pepinisame genus9.5%Episinus cavernicolasame family9.6%Euryopis formosasame genus10.0%Enoplognatha afroditesame family10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type814 records

Wild obs. + sensor696

Museum / vouchered114

Other4

Range

Area of Occupancy AOO2 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 75≤1 km 16≤10 km 227>10 km 15

333 georeferenced · 363 without coordinates

Open the mapobservation + sensor696

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 6≤10 km 14>10 km 2

22 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	7
CIBIOlocation not on record	4
Royal Museum for Central Africalocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Cambridge, US	1
	1
FETSlocation not on record	1

7 institutions · 18 of 114 vouchered records shown · 96 without an institution code

09Environmental DNA133 detections

Where the DNA of Euryopis episinoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found133

Studies independent surveys2

Countries11

Verifiable raw sequence linked19

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 133 detections have coordinates

Open the map11 countries0

Mopane/Bushwillow Woodlands5. Wetlands (inland) | 5.16. Permanent Salin…4. Native Grassland|4.6. Subtropical/Tropica…Mixed habitatDeciduous forestAlluvial Plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 17.4–27.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)28.6 °C 23.7–31.5

Min temp (night)18.0 °C 12.0–21.7

Precipitation13.7 mm/mo 1.00–106

Air humidity55.3 % 51.6–60.2

Moisture balance-93.0 mm/mo -172–-30.7

Vapour deficit1,283 Pa 907–1,577

Wind speed2.90 m/s 1.90–4.10

Cloud cover15.7 % 8.20–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)