Euryomyrtus maidenii

(Ewart & Jean White) Trudgen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Euryomyrtus

At a glance

Occurrence records245

Data sources9

Biological traits24

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Euryomyrtus maidenii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF245 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Euryomyrtus maidenii is a shrub endemic to Western Australia. The erect, compact or spreading shrub typically grows to a height of 0.1 to. It blooms between March and October producing purple-pink flowers. It is found on sand plains in the Wheatbelt, Mid West and Goldfields-Esperance regions of Western Australia where it grows in sandy soils over laterite.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length2 mm

Fruit width2.25 mm

Leaf length0.9 mm

Leaf width0.85 mm

Petiole length0.005 cm

Plant height0.5 m

Plant height max0.9 m

Plant height min0.1 m

Seed length1.65 mm

Seed width0.775 mm

Life cycle & reproduction4

Flowering timennyyyyyyyynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_oblong oblong orbicular widely_ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euryomyrtus maidenii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAF489375.1 ↗1 261 bp

ACGT

ATGGAGGAATTTCAAGGATATTTAGAACTAGATAGATCTCGACAACATGACTTACTATACCCACTTCTTTTTCGAGAGTATATTTATGCA …

Euryomyrtus maidenii isolate s28 trnK gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Euryomyrtus maidenii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rye, B. L. 1979. Chromosome number variation in the Myrtaceae and its taxonomic implications. Austral. J. Bot. 27: 547–573.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type245 records

Wild obs. + sensor27

Museum / vouchered218

Origin

Native20

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 16≤1 km 1≤10 km 3>10 km 4

24 georeferenced · 3 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 52≤1 km 27≤10 km 84>10 km 12

175 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	130
Canberra, AU	31
Mount Annan, AU	19
Museo Entomologico de Leonlocation not on record	16
BGPAlocation not on record	7
Adelaide, AU	6
Kew, GB	3
Brisbane, AU	2
Claremont, US	1
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Palmerston, AU	1

12 institutions · 218 of 218 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Euryomyrtus maidenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)