Eurycoma longifolia

Jack · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Simaroubaceae/Eurycoma

At a glance

Occurrence records594

Data sources10

Biological traits16

DNA specimens12

eDNA detections8

Sources10 archives

Databases and archives Eurycoma longifolia's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility594 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS251 compounds

Occurrence & distributionGBIF594 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Eurycoma longifolia (commonly called tongkat ali, pasak bumi, or longjack) is a flowering plant in the family Simaroubaceae. It is native to Indochina (Cambodia, Laos, Malaysia, Myanmar, Thailand and Vietnam) and Indonesia (the islands of Borneo and Sumatra), but has also been found in the Philippines. The plant is a medium-sized slender shrub that can reach 10 m in height, and is often unbranched. The root of the plant has been used in folk medicine of the South East Asian region, and in modern times has common use as supplements, as well as food and drink additives.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height8 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf p1.28 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)23.38 mm²/mg

Wood density505 mg/cm³

03Chemical composition251 compounds

Compounds documented for Eurycoma longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quassinoids143

Carboline alkaloids84

Lanostane, Tirucallane and Euphane triterpenoids10

Pseudoguaiane sesquiterpenoids8

Oxasqualenoids8

Documented compounds251 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R)-1-[4-[4-[(E)-3-hydroxyprop-1-enyl]-2-methoxyphenoxy]-3-methoxyphenyl]propane-1,2,3-triol	present	LOTUS
(1R,2R,3R,6R,7S,8R,9S,12S,13R,14R,15R,16R)-3,6,8,14,15-pentahydroxy-2,6,13,16-tetramethyl-10-oxatetracyclo[7.6.1.02,7.012,16]hexadec-4-en-11-one	present	LOTUS
(1R,2R,3S,5R,8R,9R,10S,11R,12S)-8,9,11,12-tetrahydroxy-3,10-dimethyl-3-[(2S)-3-methyl-5-oxo-2H-furan-2-yl]-6,13-dioxatetracyclo[7.5.0.01,5.02,12]tetradecan-7-one	present	LOTUS
(1R,2R,3S,5R,8R,9R,11R,12R)-8,9,11,12-tetrahydroxy-3-methyl-10-methylidene-3-[(2R)-3-methyl-5-oxo-2H-furan-2-yl]-6,13-dioxatetracyclo[7.5.0.01,5.02,12]tetradecan-7-one	present	LOTUS
(1R,2R,3S,5R,9R,10R,11S,12R,13S,16R)-3,9,12-trihydroxy-2,6,10,16-tetramethyl-14-oxatetracyclo[11.2.1.02,11.05,10]hexadec-6-ene-8,15-dione	present	LOTUS
(1R,2R,3S,9R,12S,13R,14R,15R,16R)-3,14,15-trihydroxy-2,6,9,13,16-pentamethyl-10-oxatetracyclo[7.6.1.02,7.012,16]hexadeca-5,7-diene-4,11-dione	present	LOTUS
(1R,2R,4S,5R,8S,9R,10S,11S,12R,13S,16S)-4,8,9,12-tetrahydroxy-2,6,10,16-tetramethyl-14-oxatetracyclo[11.2.1.02,11.05,10]hexadec-6-ene-3,15-dione	present	LOTUS
(1R,2R,4S,5S,9R,10R,11R,12R,13S,16S)-4,9,12-trihydroxy-2,6,10,16-tetramethyl-14-oxatetracyclo[11.2.1.02,11.05,10]hexadec-6-ene-3,8,15-trione	present	LOTUS
(1R,2R,5R,8R,9R,10R,11S,12R,13S,16S)-8,9,12-trihydroxy-2,6,10,16-tetramethyl-14-oxatetracyclo[11.2.1.02,11.05,10]hexadec-6-ene-3,15-dione	present	LOTUS
(1R,2R,5S,5aR,10aR,10bS,11R)-5,5a,10a,10b-Tetrahydro-1-hydroxy-5a,8,10a,11-tetramethyl-2,5-methano-2H-indeno[4,5-d]oxepin-4,6,10(1H)-trione	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurycoma longifolia has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes3

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY264053.1 ↗278 bpMalaysia · 2016

ACGT

GTGGAATGCTGCGGTGGCAAATTCGAGTCCCGGCGGCGGTCGCCGCGACTGATCGGTGGCGAAAATTTCTTTCATCGAGTTCCCGTCGTG …

Eurycoma longifolia internal transcribed spacer 2 and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL6★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type594 records

Wild obs. + sensor219

Museum / vouchered375

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 51≤1 km 54≤10 km 6>10 km 9

120 georeferenced · 99 without coordinates

Open the mapobservation + sensor219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 3≤10 km 5>10 km 6

15 georeferenced · 360 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	99
Kew, GB	19
Moscow State Universitylocation not on record	10
Xiamen, CN	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
Bronx, US	4
University of Stellenboschlocation not on record	4
Edinburgh, GB	4
Kagoshima, JP	3
Saint Louis, US	3
Uppsala, SE	3
National Institute of Biological Resourceslocation not on record	2
Cambridge, US	1

13 institutions · 162 of 375 vouchered records shown · 213 without an institution code

09Environmental DNA8 detections

Where the DNA of Eurycoma longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)