Eurybia schreberi

(Nees) Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eurybia

At a glance

Occurrence records715

Data sources11

Biological traits8

DNA specimens15

eDNA detections12

Sources11 archives

Databases and archives Eurybia schreberi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF715 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Eurybia schreberi, commonly called Schreber's aster or nettle-leaved Michaelmas-daisy, is a perennial herb in the family Asteraceae. It is native to eastern North America, where it is present in Canada and the United States. The flower heads emerge in the late summer or early fall to show white ray florets and yellow disc florets. It is listed as endangered in Indiana and Iowa, of special concern in Tennessee and possibly extirpated in Maine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.978 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurybia schreberi has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219791.1 ↗340 bpUSA · 1971

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Eurybia schreberi voucher CCDB-22989-G11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eurybia schreberi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records18–542n range54median54mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 546×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · ipcn-api-dl — Semple, J. C. & L. Brouillet. 1980. Chromosome numbers and satellite chromosome morphology in Aster and Lasallea. Amer. J. Bot. 67(7): 1027–1039.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · ipcn-api-dl — Jones, A. G. 1980. Data on chromosome numbers in Aster (Asteraceae) with comments on the status and relationships of certain North American species. Brittonia 32(2): 240–261.

CCDB · eflora

2n 181×CCDB · book-ipcn66

CCDB · book-ipcn66 — E. B. Smith 1966b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type715 records

Wild obs. + sensor222

Museum / vouchered490

Cultivated / captive3

Origin

Native1

Introduced1

Range

Area of Occupancy AOO1 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 81≤1 km 43≤10 km 36>10 km 39

199 georeferenced · 23 without coordinates

Open the mapobservation + sensor222

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 6≤1 km 67≤10 km 216>10 km 12

301 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence490

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	136
Bronx, US	97
University of Stellenboschlocation not on record	52
New Haven, US	48
Burlington, US	25
Chongqing Museumlocation not on record	19
Bloomington, US	10
University of New Hampshirelocation not on record	10
Philadelphia, US	8
LDlocation not on record	8
Wuzhou, CN	7
Morgantown, US	5
College Park, US	5
Keene State Universitylocation not on record	4
South Kensington, GB	3
Chapel Hill, US	3
Montréal, CA	3
Hudson, US	2
Oskarshamn, SE	2
Norfolk, US	2
Little Rock, US	2
Bangkok, TH	2
Mississippi State, US	2
Clemson, US	2
Minia, EG	2
Vancouver, CA	1
Tuscaloosa, US	1
Whitehorse, CA	1
Lord Fairfax Community Collegelocation not on record	1
Fredericksburg, US	1
Elikins, US	1
Whitewater, US	1
Fairfax, US	1
University of Guelph, OAC Herbariumlocation not on record	1
Portland, US	1
DBF-NHMDlocation not on record	1
Dekalb, US	1
GAlocation not on record	1

38 institutions · 472 of 490 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Eurybia schreberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Moist roadside bank shaded part of day.Road bank.Moist woods.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 19.6–19.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.8 °C

Min temp (night)15.5 °C

Precipitation81.3 mm/mo

Air humidity59.1 %

Moisture balance-51.0 mm/mo

Vapour deficit931 Pa

Wind speed3.20 m/s

Cloud cover40.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)