Eurybia saxicastellii

(J.J.N.Campb. & Medley) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eurybia

At a glance

Occurrence records22

Data sources8

Biological traits7

DNA specimens0

eDNA detections8

Sources8 archives

Databases and archives Eurybia saxicastellii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 54

01Narrative

Eurybia saxicastellii là một loài thực vật có hoa trong họ Cúc. Loài này được G.L.Nesom mô tả khoa học đầu tiên năm 1995.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurybia saxicastellii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

eDNA detections8

The DNA barcodea real sequence read deposited for this species

ITSEU625619.1 ↗627 bp

ACGT

TCGAAGCCTACAAAGCTGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGCTCGGGCATTTGTTCGATCCTCGTGGCACACC …

Eurybia saxicastelli clone 6 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eurybia saxicastellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records54–542n range54median54mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 542×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Campbell, J. J. & M. E. Medley. 1989. Aster saxicastellii (Asteraceae), a new species from the Rockcastle River bars in southeastern Kentucky. Sida 13: 277–284.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type22 records

Wild obs. + sensor10

Museum / vouchered12

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 10

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Richmond, US	9
Montréal, CA	3

2 institutions · 12 of 12 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Eurybia saxicastellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)