Eurybia radulina

(A.Gray) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eurybia

At a glance

Occurrence records1 201

Data sources11

Biological traits5

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Eurybia radulina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF1 201 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Eurybia radulina (formerly Aster radulinus), commonly known as the roughleaf aster, is an herbaceous perennial in the family Asteraceae. It is native to western North America, where it is present primarily west of the Cascade Range in both Canada (British Columbia including Vancouver Island) and the United States (Washington, Oregon, and California including the Channel Islands).Turner Photographics, Aster radulinus - Wildflowers of the Pacific Northwest photos, description, partial range map Its habitats include dry rock outcrops, slopes, edges of forests, and oak woodlands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.436 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Forb/herb, Subshrub

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurybia radulina has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219051.1 ↗340 bpUSA · 1953

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Eurybia radulina voucher CCDB-22990-G02 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eurybia radulina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 273×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 201 records

Wild obs. + sensor902

Museum / vouchered299

Origin

Native1

Range

Area of Occupancy AOO2 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 555≤1 km 88≤10 km 33>10 km 23

699 georeferenced · 203 without coordinates

Open the mapobservation + sensor902

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 12≤1 km 87≤10 km 62>10 km 1

162 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence299

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	38
Pullman, US	34
Santa Barbara, US	26
Portland, US	19
Arcata, US	17
San Luis Obispo, US	13
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	9
Davis, US	7
Canadian Department of Agriculturelocation not on record	6
Bronx, US	6
CASlocation not on record	5
Riverside, US	5
Victoria, CA	5
Claremont, US	5
San Diego, US	4
San Jose, US	4
Toronto, CA	3
US	2
St. Paul, US	2
Bloomington, US	2
Santa Cruz, US	2
WTUlocation not on record	2
US	2
Bangkok, TH	1
Los Angeles, US	1
University of Stellenboschlocation not on record	1
Moscow, US	1
KNFYlocation not on record	1
KNFHClocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Provo, US	1
Portland, US	1
Vancouver, CA	1
Boise, US	1
Flagstaff, US	1
Wuzhou, CN	1

37 institutions · 232 of 299 vouchered records shown · 67 without an institution code

09Environmental DNA2 detections

Where the DNA of Eurybia radulina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

Open ponderosa pine woods.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eurybia radulina

At a glance

Sources11 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 201 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions28 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 201 records