Eurybia glauca

(Nutt.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eurybia

At a glance

Occurrence records244

Data sources8

Biological traits88

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Eurybia glauca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources88 traits

Occurrence & distributionGBIF244 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Herrickia glauca is a North American species of flowering plants in the family Asteraceae, called the gray aster. It is native to the western United States, primarily in Arizona, New Mexico, Utah, Colorado, and Wyoming, with a few populations in Idaho and Montana.Nesom, G. L. (2009). Taxonomic overview of Eurybia sect. Herrickia (Asteraceae: Astereae). Journal of the Botanical Research Institute of Texas 3(1): 161–167. includes distribution map on page 164, as Eurybia glaucaBiota of North America Program 2014 county distribution map, Herrickia glauca Herrickia glauca is a perennial herb or subshrub up to 70 centimeters (28 inches) tall from a woody rhizome. The plant produces flower heads numerous heads (sometimes over 100) in a flat-topped array. Each head contains 8-19 lavender ray florets surrounding 12-32 yellow or purplish disc florets.Flora of North America, Herrickia glauca (Nuttall) Brouillet, 2004. Gray aster Herrickia glauca (Nutt.) Brouillet as Aster Glaucus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.61 m

Seed mass0.586 mg

Life cycle & reproduction23

After harvest regrowth rateSlow

Bloom periodMid Summer

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life spanperennial

Lifespan categoryShort

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment23

Active growth periodSpring, Summer, Fall

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorYellow-Green

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min10 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min130 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max20 in

Precipitation min10 in

Salinity toleranceLow

Shade toleranceHigh

Soil pH max8 pH

Soil pH min5.9 pH

Temperature min-43 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound800 000 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousYes

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceYes

Planting density max11 000 per acre

Planting density min2 700 per acre

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurybia glauca has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY772424.1 ↗627 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGAAGGGTCAGGCGTTTGTTTGATCCTCGTGGCACACC …

Herrickia glauca internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eurybia glauca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.

CCDB · eflora

n 92×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jones, A. G. & R. A. Smogor. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.

CCDB · ipcn-api-dl — Hartman, R. L. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type244 records

Wild obs. + sensor162

Museum / vouchered82

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 100≤1 km 10≤10 km 5>10 km 5

120 georeferenced · 42 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 8≤10 km 16

26 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Phoenix, US	22
Denver, US	18
Albuquerque, US	10
ASUlocation not on record	9
Pocatello, US	6
Missoula, US	5
University of Stellenboschlocation not on record	2
Provo, US	2
Logan, US	2
San Diego, US	1
Moscow, US	1
US	1
Durango, US	1
US	1
Riverside, US	1

15 institutions · 82 of 82 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Eurybia glauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)