Eurybia eryngiifolia

(Torr. & A.Gray) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eurybia

At a glance

Occurrence records319

Data sources9

Biological traits7

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Eurybia eryngiifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaTgenome

01Narrative

Eurybia eryngiifolia, commonly known as the thistleleaf aster or coyote-thistle aster, is an herbaceous perennial in the family Asteraceae. It is native to the eastern United States where it is only present along the Florida panhandle and the nearby areas of southern Alabama and southwestern Georgia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurybia eryngiifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY772420.1 ↗625 bp

ACGT

TCGAAGCCTGCAAAGCATAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGTCGGGCATTTGTTCGATCCTTGTGGCACACCG …

Eurybia eryngiifolia internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eurybia eryngiifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type319 records

Wild obs. + sensor205

Museum / vouchered114

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 61≤1 km 14≤10 km 7>10 km 105

187 georeferenced · 18 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤10 km 4>10 km 4

10 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	59
Tampa, US	14
Tall Timbers Research Stationlocation not on record	7
Bangkok, TH	7
Wuzhou, CN	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
University of Stellenboschlocation not on record	3
Bronx, US	2
Columbia, US	2
Mississippi State, US	1
Stockholm, SE	1
Québec, CA	1
Dekalb, US	1
Chapel Hill, US	1
Montréal, CA	1
AUAlocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Austin, US	1

18 institutions · 112 of 114 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Eurybia eryngiifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)