Euryale ferox

Salisb. ex K.D.Koenig & Sims · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Nymphaeales/Nymphaeaceae/Euryale

At a glance

Occurrence records315

Data sources10

Biological traits25

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Euryale ferox's data was compiled from.

GBIFGlobal Biodiversity Information Facility315 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources25 traits

Chemical compositionNPASS36 compounds

Occurrence & distributionGBIF315 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT897 Mbp

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length40 mm

Fruit length max50 mm

Fruit length min30 mm

Fruit width40 mm

Fruit width max50 mm

Fruit width min30 mm

Plant height1 m

Seed mass60.35 mg

Seed mass max60.35 mg

Seed mass min60.35 mg

Life cycle & reproduction5

Flowering endSep

Flowering startJul

Life formhydroperennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Aquatic

Habitat GIFTaquatic, lakes

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition36 compounds

Compounds documented for Euryale ferox across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Guaiane sesquiterpenoids10

Purine nucleos(t)ides7

Pyrimidine nucleos(t)ides5

Purine alkaloids3

Imidazole alkaloids1

Documented compounds36 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4E,8E,2'r)-1-O-(Beta-Glucopyranosyl)-N-(2'-Hydroxydocosanoyl)-4,8-Sphingadienine	present	NPASS
(2S,3R,4E,8E,2'r)-1-O-(Beta-Glucopyranosyl)-N-(2'-Hydroxytetracosanoyl)-4,8-Sphingadienine	present	NPASS
(3aS,5R,6aR,8S,9aR,9bS)-5-hydroxy-3,6,9-trimethylidene-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
2'-Deoxyinosine	present	NPASS
5-(6-Aminopurin-9-Yl)-2-(Hydroxymethyl)Oxolan-3-Ol	present	NPASS
8-Epicrepiside E	present	NPASS
[(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R)-2-hydroxy-3-methylbutanoate	present	NPASS
[(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R,3S)-2-hydroxy-3-methylpentanoate	present	NPASS
[(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[2-(4-hydroxyphenyl)acetyl]oxymethyl]oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R)-2-hydroxy-3-methylbutanoate	present	NPASS
[(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[2-(4-hydroxyphenyl)acetyl]oxymethyl]oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R,3S)-2-hydroxy-3-methylpentanoate	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euryale ferox has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMF802932.1 ↗214 bp

ACGT

CGCTTAGCGTCGCCCTCCCTAAGTTTTAAGGGAGAGCGGAGGATTGGCCATCGATGCCATGAATGATTGGTGTCGTTGGCTGAAAATTCT …

Euryale ferox isolate YC0134MT03 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Euryale ferox carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size897 315 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euryale ferox0.90 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Ploidypolyploid inferred

Chromosome records58–582n range58median58mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 5811×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Rudyka, E. G. 1990. Chromosome numbers of vascular plants from the various regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1783–1786.

CCDB · ipcn-api-dl — Wei, P. h., W. p. Chen & R. y. Chen. 1994. Study on the karyotype analysis of Nymphaeaceae and its taxonomic position. Acta Phytotax. Sin. 32(4): 293–300.

CCDB · ipcn-api-dl — Okada, H. & M. TAMURA. 1981. Karyomorphological study on the Nymphaeales. J. Jap. Bot. 56: 367–375.

CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.

CCDB · ipcn-api-dl — Diao. 2006. Nuclear DNA C-values in 12 species in Nymphaeales. Caryologia 59: 25–30.

CCDB · book-ipcn66 — Sokolovskaya 1966

CCDB · book-indian_vol1 — Langlet, O.F.J. & S6derberg, E. 1927; Langlet, O.F.J. 1936 ; Sokolovskaya, A.P. (Fedorov); Gupta, P.P. & Roy, S.K. 1972, 1973a, b

CCDB · book-atlas-flowering-plants — Langlet & S. 1927

CCDB · kew — Diao Y, Chen L, Yang GX, Zhou MQ, Song YC, Hu ZL, Liu JY. 2006. Nuclear DNA C-values in 12 species in Nymphaeales. Caryologia 59: 25-30.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type315 records

Wild obs. + sensor157

Museum / vouchered156

Cultivated / captive1

Other1

Origin

Introduced1

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 39≤1 km 25≤10 km 10>10 km 19

93 georeferenced · 64 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence156

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	34
Nanjing, CN	30
Institute of Applied Ecology, Academia Sinicalocation not on record	12
Guangzhou, CN	9
Heilongjiang Academy of Scienceslocation not on record	5
JMSlocation not on record	5
LDlocation not on record	4
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	4
Wuhan, CN	4
Guilin, CN	3
Miami, US	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	3
National Institute of Biological Resourceslocation not on record	3
Moscow State Universitylocation not on record	3
Saint Louis, US	3
HUFDlocation not on record	3
Xinxiang, CN	2
ENTClocation not on record	2
Yangling, CN	2
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Zhejiang Universitylocation not on record	1
Awka, NG	1
Anhui Normal Universitylocation not on record	1
Xiamen, CN	1
Siouxland Heritage Museumlocation not on record	1
黔东南州民族医药研究所标本室location not on record	1
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	1
Hangzhou, CN	1
Tianjin Natural History Museumlocation not on record	1
NEAUlocation not on record	1
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
Ischia Marine Centrelocation not on record	1
Changsha, CN	1
Beijing Normal Universitylocation not on record	1
Central China Normal Universitylocation not on record	1
Strecker Museum, Baylor Universitylocation not on record	1
Nagasaki University - Fisherieslocation not on record	1

37 institutions · 152 of 156 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Euryale ferox was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)