Eurois astricta

Morrison, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Eurois

At a glance

Occurrence records1 626

Data sources7

Biological traits0

DNA specimens254

eDNA detections254

Sources7 archives

Databases and archives Eurois astricta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 626 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI254 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics254 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 626 records

Environmental DNA1 datasets · 2 countries254 detections

DNA & barcodingBOLD254 specimens

01Narrative

Eurois astricta, the great brown dart, is a species of cutworm or dart moth in the family Noctuidae. It was first described by Herbert Knowles Morrison in 1874 and it is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding254 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eurois astricta has left across the world's sequence archives.

At a glance

DNA specimens254

BINs2

Marker genes1

eDNA detections254

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus252 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

34Avariable

82Cvariable

85Cvariable

88Avariable

172Tvariable

259Tvariable

262Avariable

265Cvariable

268Avariable

292Tvariable

364Avariable

370Cvariable

376Avariable

477Gvariable

479Tvariable

487Cvariable

511Avariable

565Gvariable

641Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes26

BINs2

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eurois nigrasame genus3.8%Xestia sareptanasame family3.8%Eurois occultasame genus4.0%Spaelotis clandestinasame family4.1%Spaelotis velicavasame family4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 626 records

Wild obs. + sensor408

Museum / vouchered1 218

Range

Area of Occupancy AOO2 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 231≤1 km 63≤10 km 33>10 km 4

331 georeferenced · 77 without coordinates

Open the mapobservation + sensor408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 163≤1 km 130≤10 km 244>10 km 21

558 georeferenced · 660 without coordinates

Open the institutions mapphysical evidence1 218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	201
University of Alberta Museums (UAM)location not on record	167
Colorado State Universitylocation not on record	140
University of Guelph, Centre for Biodiversity Genomicslocation not on record	93
Edmonton, CA	84
East Lansing, US	72
Oregon State Arthropod Collectionlocation not on record	35
Denver, US	34
St. Paul, US	33
Royal Saskatchewan Museumlocation not on record	32
Helsinki, FI	26
Vernal, US	11
Cambridge, US	8
Champaign, US	6
WWUlocation not on record	6
Toronto, CA	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
KWPlocation not on record	4
OSUClocation not on record	4
National Institute of Biological Resourceslocation not on record	3
Mississippi State, US	3
UNHClocation not on record	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Brussels, BE	2
Washington, US	1
Philadelphia, US	1
ZSMlocation not on record	1
SOVTlocation not on record	1
Albuquerque, US	1
US	1

30 institutions · 986 of 1 218 vouchered records shown · 232 without an institution code

09Environmental DNA254 detections

Where the DNA of Eurois astricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found254

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 254 detections have coordinates

Open the map2 countries0

ForestP. glauca forest, distb.Mixed HabitatWetlandMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 4.50–20.5

Seasonal swing summer↔winter24.1 °C

Max temp (day)20.9 °C 8.50–26.2

Min temp (night)10.8 °C -1.00–15.2

Precipitation59.3 mm/mo 48.1–107

Air humidity57.2 % 53.1–62.1

Moisture balance-42.2 mm/mo -86.4–18.5

Vapour deficit786 Pa 378–1,101

Wind speed1.80 m/s 1.10–3.90

Cloud cover44.1 % 35.2–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 249 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eurois astricta

At a glance

Sources7 archives

At a glance

Record type1 626 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 626 records