Eupomatia laurina

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Eupomatiaceae/Eupomatia

At a glance

Occurrence records6 056

Data sources12

Biological traits43

DNA specimens19

eDNA detections7

Sources12 archives

Databases and archives Eupomatia laurina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 056 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF6 056 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB · GoaT1.2 Gbp

01Narrative

Eupomatia laurina là một loài thực vật có hoa trong họ Eupomatiaceae. Loài này được R.Br. mô tả khoa học đầu tiên năm 1814.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length22 mm

Fruit width17.5 mm

Leaf length120 mm

Leaf length max120 mm

Leaf length min70 mm

Leaf mass358 mg

Leaf mass per area60.98 g/m2

Leaf size7 565 mm²

⚠ sources differ — TRY: 7 565 mm² · AusTraits: 6 193 mm²

Leaf width44.95 mm

Leaf width max50 mm

Leaf width min20 mm

Petiole length0.55 cm

Plant height6 m

⚠ sources differ — GIFT: 6 m · AusTraits: 7.5 m · TRY: 7.51 m

Plant height max6 m

Seed length5 mm

Seed mass8.15 mg

Seed width2.5 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Pollination syndromebeetle

Raunkiær life formphanerophyte

Reproductive maturity7 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: shrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.87 mm²/mg

Wood density540 mg/cm³

03Chemical composition64 compounds

Compounds documented for Eupomatia laurina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids7

Neolignans6

p-Terphenyls3

Dibenzocyclooctadienes lignans3

Apocarotenoids(ε-)3

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(-)-Dihydroguaiaretic acid	present	LOTUS
(-)-Licarin-B	present	LOTUS
(12R,13S)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-13-ol	present	LOTUS
(1R,2S)-1-[2-(4-hydroxy-3-methoxyphenyl)-3-methyl-1-benzofuran-5-yl]propane-1,2-diol	present	LOTUS
(1R,6S,8R)-2,2,6,8-tetramethyl-7,11-dioxatricyclo[6.2.1.01,6]undec-4-ene	present	NPASS
(1S,2R,7aS)-1,4,4,7a-tetramethyl-2,4,5,7a-tetrahydro-1H-inden-2-ol	present	NPASS
(1S,9S)-2,2,9-trimethyl-8,12-dioxatricyclo[7.2.1.01,6]dodec-5-ene	present	NPASS
(2R)-1-[2-(1,3-benzodioxol-5-yl)-3-methyl-1-benzofuran-5-yl]propan-2-ol	present	LOTUS
(2R,3S,4S,5S,6S)-2-methyl-6-[4-[3-methyl-5-[(E)-prop-1-enyl]-1-benzofuran-2-yl]phenoxy]oxane-3,4,5-triol	present	LOTUS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupomatia laurina has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes7

GenBank sequences9

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536482.1 ↗359 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACC …

Eupomatia laurina voucher MO:Carlsen3321 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK3★rbcL4★rbcLa★ITS2★ITS2trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Eupomatia laurina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 173 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eupomatia laurina1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn65 — Raven & K.1965

CCDB · ipcn-api-dl — Okada, H. 1987. A report of the botanical expedition to Papua New Guinea during 29th July and 2nd September, 1985. Sci. Rep., Coll. Gen. Educ., Osaka Univ. 36: 7–32.

CCDB · ipcn-api-dl — Morawetz, W. 1988. Karyosystematics and evolution of Australian Annonaceae as compared with Eupomatiaceae, Himantandraceae and Austrobaileyaceae. Pl. Syst. Evol. 159: 49–79.

CCDB · book-ipcn73-74 — GOLDBLATT, P. 1974. In Chromosome numbers of phanerogams. 4. Ann. Missouri Bot. Gard. 61,-901-902.

CCDB · book-fedorov — Hotchkiss 1958

CCDB · book-fedorov — Raven, Kyhos 1965

CCDB · book-atlas-flowering-plants

CCDB · kew — Morawetz W, Samuel R. (pers. comm. 1998).

08Occurrence & distribution

Record type6 056 records

Wild obs. + sensor4 804

Museum / vouchered958

Cultivated / captive5

Other289

Origin

Native157

Introduced2

Range

Area of Occupancy AOO12 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 4 017≤1 km 310≤10 km 128>10 km 52

4 507 georeferenced · 297 without coordinates

Open the mapobservation + sensor4 804

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 102≤1 km 141≤10 km 340>10 km 89

672 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence958

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	177
Mount Annan, AU	159
Museo Entomologico de Leonlocation not on record	124
Smithfield, AU	121
Canberra, AU	84
Zürich, CH	72
Armidale, AU	51
John T. Waterhouse Herbariumlocation not on record	28
Kew, GB	15
Batemans Bay, AU	8
NSW Dept of Planning, Industry and Environmentlocation not on record	7
La Trobe Universitylocation not on record	7
Wollongong, AU	6
Palmerston, AU	6
Hobart, AU	6
Honolulu, US	5
Adelaide, AU	5
Davis, US	4
St. Paul, US	4
James Cook Townsvillelocation not on record	3
University of Stellenboschlocation not on record	3
Parkville, AU	3
Australian Tropical Herbariumlocation not on record	3
Saint Louis, US	2
Auckland, NZ	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Kensington, AU	1
Wellington, NZ	1
Edinburgh, GB	1
Stockholm, SE	1

31 institutions · 912 of 958 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Eupomatia laurina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 19.7–26.4

Seasonal swing summer↔winter9.00 °C

Max temp (day)28.5 °C 23.3–29.6

Min temp (night)20.8 °C 14.7–24.1

Precipitation132 mm/mo 63.7–399

Air humidity61.0 % 51.7–68.3

Moisture balance13.6 mm/mo

Vapour deficit1,075 Pa 935–1,459

Wind speed3.10 m/s

Cloud cover32.3 % 22.5–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eupomatia laurina

At a glance

Sources12 archives

Size & morphology17

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Compound class profile5 classes

Documented compounds64 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type6 056 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 056 records